ID: 1050095126

View in Genome Browser
Species Human (GRCh38)
Location 9:2056928-2056950
Sequence AAATGGACCCTTGTGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050095121_1050095126 13 Left 1050095121 9:2056892-2056914 CCAATGAATTCATCAAATGGGGT 0: 1
1: 0
2: 2
3: 13
4: 207
Right 1050095126 9:2056928-2056950 AAATGGACCCTTGTGGGTGGTGG 0: 1
1: 0
2: 1
3: 22
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050095126 Original CRISPR AAATGGACCCTTGTGGGTGG TGG Intronic
901854394 1:12035249-12035271 AAATGGAACTGTGTGGGTGCTGG - Intergenic
903845208 1:26275780-26275802 ACATGGCCCAGTGTGGGTGGAGG + Intronic
904005233 1:27360135-27360157 AAATGCACCCTAGTGCGTGTGGG - Intronic
905854806 1:41302555-41302577 AAGTGGACCCTTGTGGTTGCAGG + Intergenic
906210560 1:44010439-44010461 ACAGGGAGCCTTGTGGGCGGGGG + Intronic
906715953 1:47969412-47969434 AACTGAGCCCTTGTGAGTGGTGG - Intronic
910471178 1:87554361-87554383 ATATGGACCCTTGAGGGAGAAGG - Intergenic
912807659 1:112770736-112770758 AAACGGCCCATTTTGGGTGGAGG + Intergenic
914957517 1:152177057-152177079 CACTGGCGCCTTGTGGGTGGGGG - Intergenic
915495425 1:156279229-156279251 AAATGTCCCCTGGTGGGCGGGGG - Intronic
916709834 1:167394669-167394691 AAATAGCCACTTGTGGCTGGTGG + Intronic
919831811 1:201546454-201546476 AAATAAAACCTTGTGTGTGGGGG - Intergenic
920252233 1:204629363-204629385 ATGTGGATCCTTGAGGGTGGAGG - Intronic
920577417 1:207071850-207071872 AAAGGGACACTTGGGGTTGGAGG - Intronic
923085505 1:230700516-230700538 AAATGGACCACTCTGGGTGGGGG + Intergenic
1062902696 10:1157821-1157843 AAATGGCCATTTGGGGGTGGGGG + Intergenic
1063196284 10:3746936-3746958 AAATGGAGACTTGTGTGTGTTGG + Intergenic
1065079226 10:22111294-22111316 AATTATACCCTTGGGGGTGGTGG + Intergenic
1066447747 10:35499054-35499076 AGATTGATCCTTGTAGGTGGTGG + Intronic
1067347979 10:45451658-45451680 AAATGCACCACTGTGGGGGGGGG + Intergenic
1067829615 10:49603014-49603036 GAATGCAGCCTTGAGGGTGGGGG - Intergenic
1068955085 10:62814532-62814554 AAATGGACCTATGTGAGCGGGGG - Intronic
1070390493 10:75966429-75966451 AAATGGTCATTTCTGGGTGGTGG + Intronic
1071103424 10:82065718-82065740 AGATGGACCCTTGCAGGAGGAGG + Intronic
1072841508 10:98779343-98779365 AAATGGACACTTGGGTGGGGTGG + Intronic
1074645720 10:115449700-115449722 AAATAACCCCTTGTGGGAGGAGG - Intronic
1076273402 10:129175966-129175988 AAATTGAACATTTTGGGTGGGGG + Intergenic
1076583435 10:131530254-131530276 AAATGGGCCTTGGTGGGTGCGGG - Intergenic
1076755116 10:132565897-132565919 AATTGGAGGCTTGTGTGTGGAGG + Intronic
1077280817 11:1744622-1744644 GAATTGGCCCATGTGGGTGGGGG + Intronic
1077609922 11:3637746-3637768 AAATGGACCCTTGTGGGAGCAGG + Intergenic
1079015728 11:16867072-16867094 GGATGGACACTTGGGGGTGGGGG + Intronic
1079242846 11:18732937-18732959 AAATGGGCCCTTATGGGTACAGG + Intronic
1080927522 11:36773405-36773427 TCATGGACTATTGTGGGTGGTGG - Intergenic
1081430878 11:42975347-42975369 AAATGGAACGTTGCTGGTGGAGG - Intergenic
1082904152 11:58287796-58287818 AAATGGGGCCTGGTGGGAGGTGG + Intergenic
1083140485 11:60717408-60717430 GGATGGAGCCCTGTGGGTGGAGG - Intergenic
1083879937 11:65543354-65543376 GACTGGACCCTGGGGGGTGGGGG + Intronic
1084185820 11:67470409-67470431 AAATGAACCGTGGTGGGGGGCGG + Intergenic
1084316438 11:68348414-68348436 AAATGAACCCGTGGGGGTGTTGG + Intronic
1084316494 11:68348654-68348676 AAATGAACCCGTGGGGGTGTTGG + Intronic
1084996521 11:72984981-72985003 AATTGGATCTTTGAGGGTGGAGG - Intronic
1087919633 11:103851464-103851486 AAATGGGATTTTGTGGGTGGAGG - Intergenic
1090379374 11:126315083-126315105 AAATGCCCACTTGAGGGTGGAGG + Intronic
1093296746 12:17400824-17400846 AAATGTGCCCTTGTTGCTGGAGG + Intergenic
1093503030 12:19834019-19834041 AAATGGAACCGTGTGTGTGTGGG - Intergenic
1096145813 12:49277801-49277823 AAATAGACCCTTGGGTGTGGGGG + Intergenic
1098072257 12:66688634-66688656 AAAAGGACCCTTCTGGGTTTTGG - Intronic
1099516732 12:83605978-83606000 AACTGGAACCTGGTAGGTGGAGG + Intergenic
1101767553 12:107716263-107716285 AAAAGGATCTTTTTGGGTGGTGG + Intergenic
1103188404 12:118980945-118980967 AAATGGCACTTTCTGGGTGGTGG + Intergenic
1103614890 12:122145751-122145773 CAGTGGACCCCTGTGTGTGGGGG + Exonic
1103688711 12:122753055-122753077 GAAGGGGCCCTTGTGGGCGGGGG - Intronic
1104091038 12:125517978-125518000 AAATGGCCATTTGTGGCTGGTGG + Intronic
1104399138 12:128461297-128461319 ACAAGGAGCATTGTGGGTGGGGG + Intronic
1107116896 13:36756614-36756636 AAATGGGCCCTTGTGTTTGATGG - Intergenic
1107753389 13:43593598-43593620 AAATGGACCCTCAGGGGTGAGGG - Intronic
1111730267 13:92066324-92066346 GAATGGACCATTGTGGCTGAAGG + Intronic
1114200465 14:20515383-20515405 AAAGGGACCCTTGAGGGCAGTGG - Intergenic
1115020003 14:28667494-28667516 ACTTGAACCCTGGTGGGTGGAGG - Intergenic
1120206738 14:81595434-81595456 AAATGGAAACTTATTGGTGGGGG + Intergenic
1121025094 14:90609683-90609705 ACACGGTCCCCTGTGGGTGGGGG + Intronic
1126275851 15:46879903-46879925 AAATAATACCTTGTGGGTGGGGG + Intergenic
1128221471 15:65971712-65971734 AATTGGACACCTGGGGGTGGAGG - Intronic
1128269450 15:66295195-66295217 AAAAGGTCCCTTGTCGGAGGGGG + Intronic
1128945888 15:71820512-71820534 AAATATCCCCTTGTGGGTAGAGG - Intergenic
1129153402 15:73703099-73703121 AAATGTCCCCTTGGGGGAGGGGG + Intronic
1130933166 15:88447034-88447056 CAAAGGAACTTTGTGGGTGGTGG + Intergenic
1132017205 15:98328675-98328697 AAATGGGCACTTGTGGCTTGGGG - Intergenic
1133378012 16:5305697-5305719 AGATGGACACTTCTGGGTGGTGG + Intergenic
1134852533 16:17492377-17492399 AAAGGAACCGTTGTGGGTGGGGG - Intergenic
1137540301 16:49357120-49357142 AAGAGGACCCTGGTGGGAGGAGG - Intergenic
1138820048 16:60248164-60248186 AAATTGACCTTTATGGATGGAGG + Intergenic
1139284931 16:65804046-65804068 AAATGGCCACTTGTGGGTAAAGG - Intergenic
1139689089 16:68628162-68628184 AAATGGACACCTGTGGGGTGGGG + Intergenic
1140293304 16:73684677-73684699 AAAAGGACCCTTGTGATTGCAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142342403 16:89532151-89532173 AAAGGGACACGGGTGGGTGGGGG + Intronic
1143547120 17:7604039-7604061 AACAGGAACCTTGTGGCTGGTGG - Exonic
1143828367 17:9631181-9631203 ACATGGAGCCTTGTAGGTGATGG - Intronic
1146481682 17:33210056-33210078 AAATGACCCCCAGTGGGTGGGGG - Intronic
1147595095 17:41711966-41711988 ATAGGGACCTTTGTGGGTGGTGG - Intergenic
1148357371 17:46984467-46984489 AAATAGTCCCATGTGGGTGGTGG - Intronic
1148475438 17:47925564-47925586 AATTTGACCTCTGTGGGTGGAGG - Intronic
1149468587 17:56898532-56898554 AAATGGATCCTTGGGGGAGGGGG + Intronic
1150156311 17:62856457-62856479 TAATGAACTATTGTGGGTGGTGG - Intergenic
1152866609 17:82727460-82727482 AAGTGAACCCCTGTGGGTGCGGG + Exonic
1155808444 18:30202042-30202064 AAATGAACCATTGTGGATGTTGG + Intergenic
1156054075 18:32976975-32976997 AAATTGTCTGTTGTGGGTGGAGG + Intronic
1157457993 18:47854809-47854831 AAATGGACCATTGTGGTTTGCGG - Intronic
1158839246 18:61365878-61365900 AAATTGACCTTTGAGGGTGTAGG + Intronic
1161556314 19:4944632-4944654 CAATGAATCCTTGGGGGTGGGGG + Intronic
1162848972 19:13416033-13416055 TAATCATCCCTTGTGGGTGGTGG - Intronic
1163302722 19:16457935-16457957 AAGTGGGCCCTTGTGGGAGGCGG - Intronic
1165202646 19:34157902-34157924 AAATTGACTCTTTTGGGTGAGGG + Intergenic
1168281939 19:55310620-55310642 CAATGGCCTCTTGTAGGTGGAGG + Intronic
926679502 2:15653036-15653058 AATGGGACCCCTGTGGGTGGGGG + Intergenic
926739611 2:16100466-16100488 ACATGGGCCCTTGTGAGTGTGGG + Intergenic
928596573 2:32864577-32864599 AAATGGAACCTTCTGGTTGGAGG - Intergenic
928705302 2:33943228-33943250 AAATAGCCACATGTGGGTGGTGG + Intergenic
929057547 2:37891363-37891385 AAGGGGATCCCTGTGGGTGGTGG - Intergenic
929937057 2:46300567-46300589 AACTGAAGCCTGGTGGGTGGGGG + Intronic
934303406 2:91798395-91798417 AAAGGCAACCTTGTAGGTGGTGG - Intergenic
934329855 2:92054362-92054384 AAAGGCAACCTTGTAGGTGGTGG + Intergenic
934468076 2:94284267-94284289 AAAGGCAACCTTGGGGGTGGTGG + Intergenic
935359118 2:102232766-102232788 AAATGGACCCCTGAGGGAGGTGG - Intronic
935457966 2:103292726-103292748 AAATTGATTCTTGGGGGTGGGGG - Intergenic
940609886 2:155976944-155976966 AGATGAACATTTGTGGGTGGTGG - Intergenic
942228601 2:173838503-173838525 AAATGGGCCCATGAGGGTGTGGG + Intergenic
944138571 2:196429327-196429349 AAATGGACCCTTGTGGGGTCTGG + Intronic
945965818 2:216185316-216185338 AAATTGGCCATTGTGGGTAGAGG - Intronic
946628892 2:221644961-221644983 AAATGTCCCTCTGTGGGTGGGGG + Intergenic
947003562 2:225485987-225486009 AAATGTCTCCTTGTGGGCGGTGG + Intronic
948683470 2:239654571-239654593 AAATGCAGCATTGTAGGTGGTGG - Intergenic
1170102869 20:12721469-12721491 AAATAGCCCCTTGTGGCTAGGGG + Intergenic
1171349772 20:24493765-24493787 CAATGGTCCCCTGAGGGTGGGGG - Intronic
1175736262 20:61389704-61389726 AATTGGCACCTGGTGGGTGGGGG + Intronic
1177207082 21:18022628-18022650 AACTAGACACTTGTGGCTGGGGG - Intronic
1180083032 21:45495170-45495192 ACAAGGACCCTTTTGGGAGGAGG - Intronic
1183274087 22:36880630-36880652 AAGTGGACCCTTATGGGAGGTGG + Intergenic
1183357068 22:37365220-37365242 AAATGAGCCCTTGTGGCTGCAGG - Intergenic
1184040431 22:41939964-41939986 AAATGGACCCCTCTGGCTGCCGG - Intronic
1184168657 22:42745539-42745561 GAATGTCCCCTGGTGGGTGGTGG - Intergenic
1184181073 22:42826691-42826713 AAATGCAGCATTGTGGCTGGGGG - Intronic
1184639732 22:45864082-45864104 AAATGCCCCCTGGTGGGGGGAGG - Intergenic
950019840 3:9779501-9779523 ACCTGGACCCTTGGGGGAGGGGG + Intronic
950240584 3:11366379-11366401 AAATGCCACCTTGTGTGTGGGGG - Intronic
950559763 3:13714705-13714727 AATGGGACCCTTGTGTGAGGAGG + Intergenic
950839861 3:15957513-15957535 CAATGGACCCATGTGGCTAGTGG + Intergenic
951436544 3:22671341-22671363 ATATGGACATTTGTTGGTGGGGG + Intergenic
952747655 3:36796185-36796207 TACTGGAATCTTGTGGGTGGAGG - Intergenic
953659395 3:44880530-44880552 ATATGGACACTGGGGGGTGGGGG + Intronic
955587673 3:60499150-60499172 ACCTGGACCCTTGGGGCTGGGGG + Intronic
957529979 3:81428594-81428616 AAATGGAGCCTTGTGAGTAATGG + Intergenic
959134868 3:102405281-102405303 AAATGGAATCTTGTGGGTGTTGG - Intronic
962704592 3:138030680-138030702 AAATGGACATTTTTGGATGGTGG - Intronic
965492991 3:169362792-169362814 AAAGGGGCCCTTGTGTATGGTGG - Intronic
969486488 4:7475163-7475185 AAGTGGATCCTTATGGCTGGAGG + Intronic
970529332 4:16966292-16966314 AAATGGAGCCATGTGGGAGAAGG - Intergenic
971263282 4:25076353-25076375 CAAAGGACCCTGGTGGGTGGTGG - Intergenic
972979512 4:44678623-44678645 ATGTGGACCCTCGTGGGTCGGGG + Exonic
976152325 4:82104797-82104819 CAAGGGCCCCTGGTGGGTGGAGG + Intergenic
981856906 4:149305731-149305753 AAATATAACATTGTGGGTGGGGG + Intergenic
985471999 5:52550-52572 AAATAGACCTTTATGCGTGGCGG + Intergenic
992710360 5:79446939-79446961 AAATGCACCCTTTAGTGTGGTGG - Intronic
993377289 5:87164043-87164065 AAATGGAGTGTTGTGGGGGGCGG + Intergenic
994505931 5:100642528-100642550 GAATTGACCCCTTTGGGTGGTGG - Intergenic
996624644 5:125555787-125555809 AAACGGACCCTTGGGAGTCGGGG + Intergenic
997229338 5:132231344-132231366 AAATGGTATCTTCTGGGTGGAGG - Intronic
997561689 5:134851436-134851458 AAATGTTCCCTGGGGGGTGGGGG - Intronic
998371170 5:141662300-141662322 AGATGGGCCGTGGTGGGTGGTGG - Intronic
998503202 5:142651442-142651464 AAATGGACCAGTGTGGTTGGTGG - Intronic
999593128 5:153171020-153171042 GAATGGGCTTTTGTGGGTGGGGG - Intergenic
1000431016 5:161152488-161152510 AAATGAAGCCATGAGGGTGGGGG + Intergenic
1001411736 5:171517153-171517175 AAATGGAACATGGTGGCTGGGGG - Intergenic
1006305993 6:33219098-33219120 ACCTGGACACATGTGGGTGGGGG - Intergenic
1007116648 6:39347890-39347912 AAATGGACATTGGTGGGTGAGGG - Intronic
1007299628 6:40857053-40857075 ACATGAACCCTTGTGAGTGGAGG - Intergenic
1008409220 6:51153831-51153853 AAATGGACCCAAGTGGGTGATGG + Intergenic
1008646460 6:53519426-53519448 CAGTGGACTCTGGTGGGTGGAGG - Intronic
1013749790 6:113391576-113391598 CAATGCAACCTTCTGGGTGGAGG - Intergenic
1014268775 6:119312764-119312786 AAATGCACCACTGTGGGTTGAGG + Intronic
1015519119 6:134114093-134114115 AAATTGACCCTAAAGGGTGGAGG - Intergenic
1017651716 6:156589353-156589375 GAATGGACCTCAGTGGGTGGGGG - Intergenic
1017761335 6:157572228-157572250 AAGTGGGACCTAGTGGGTGGTGG - Intronic
1020042713 7:5016298-5016320 TAATGGACCCTTCTGGATGAAGG + Intronic
1020289447 7:6711545-6711567 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1020565324 7:9787759-9787781 ATATTGACCCTGGAGGGTGGTGG + Intergenic
1023559170 7:41454394-41454416 AAGTGCAGCCTTGTTGGTGGTGG - Intergenic
1023826491 7:44013495-44013517 TAATGGACCCTTCTGGTTGAAGG - Intergenic
1024316764 7:48027081-48027103 AAATGGACCCATGTGGGTATGGG + Intronic
1024927780 7:54636115-54636137 AAGTGGACGTTTGTGGGAGGAGG - Intergenic
1026480602 7:70775914-70775936 AAATGAATCCTGGTGGTTGGGGG + Intronic
1026746381 7:73016493-73016515 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1026750032 7:73044636-73044658 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1026753680 7:73072746-73072768 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1026757331 7:73100782-73100804 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1027032484 7:74901051-74901073 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1027090073 7:75292704-75292726 TAATGGACCCTTCTGGTTGAAGG - Intergenic
1027093718 7:75320632-75320654 TAATGGACCCTTCTGGTTGAAGG - Intergenic
1027097361 7:75348599-75348621 TAATGGACCCTTCTGGTTGAAGG - Intergenic
1027321986 7:77019073-77019095 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1027325620 7:77046993-77047015 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1027643609 7:80768646-80768668 AAATGGATGCATGTGGTTGGAGG + Intronic
1029398468 7:100325593-100325615 TAATGGACCCTTCTGGTTGAAGG - Intergenic
1029717838 7:102342344-102342366 TAATGGACCCTTCTGGTTGAAGG + Intergenic
1029754777 7:102566899-102566921 TAATGGACCCTTCTGGTTGAAGG - Intronic
1029772727 7:102665979-102666001 TAATGGACCCTTCTGGTTGAAGG - Intronic
1030322068 7:108179568-108179590 CAAGGGAGCCTTGTGGGTGAGGG - Intronic
1031137646 7:117902485-117902507 AAATGGTCCCCTGTGGCTGTTGG + Intergenic
1032001773 7:128270659-128270681 CAAGGGACCCTTGTGGGGTGTGG + Intergenic
1032316703 7:130844749-130844771 AAATGGCCACATGTGGCTGGTGG - Intergenic
1032601506 7:133301128-133301150 AGGTGGACACTTGAGGGTGGAGG + Intronic
1035483903 7:159207552-159207574 AGATGCACCTGTGTGGGTGGAGG + Intergenic
1036279989 8:7392639-7392661 ATAAGGACCCTTATGGGTGATGG + Intergenic
1036341536 8:7919244-7919266 ATAAGGACCCTTATGGGTGATGG - Intergenic
1036523046 8:9510047-9510069 ATAAGTAGCCTTGTGGGTGGAGG + Intergenic
1036596473 8:10217340-10217362 AAATAGTCCCTTGTGGGGAGAGG - Intronic
1037020539 8:13964960-13964982 AACTGGAAACTTGTGGGTGGTGG + Intergenic
1038253056 8:25924399-25924421 AAACAGAACCCTGTGGGTGGAGG - Intronic
1041436393 8:57846690-57846712 AAATGGATCTTTTTGGGAGGAGG + Intergenic
1046785310 8:118259407-118259429 CAATGGCATCTTGTGGGTGGAGG + Intronic
1047869004 8:129061529-129061551 CAATGTACCCTTTTGGGTGATGG + Intergenic
1048931970 8:139322452-139322474 AAAGGGACTCTGGAGGGTGGAGG - Intergenic
1050095126 9:2056928-2056950 AAATGGACCCTTGTGGGTGGTGG + Intronic
1051618090 9:19025950-19025972 AAATGGCCCATTGTGGGAGTTGG + Intronic
1051721045 9:20037801-20037823 AAATGGCCTCTAGTAGGTGGGGG + Intergenic
1053698491 9:40662311-40662333 AAATGCAACCTTGGAGGTGGTGG + Intergenic
1054309780 9:63461712-63461734 AAATGCAACCTTGGAGGTGGTGG + Intergenic
1054408568 9:64785862-64785884 AAATGCAACCTTGGAGGTGGTGG + Intergenic
1054441723 9:65269677-65269699 AAATGCAACCTTGGAGGTGGTGG + Intergenic
1054488561 9:65751821-65751843 AAATGCAACCTTGGAGGTGGTGG - Intergenic
1054996038 9:71390885-71390907 AAATGGGCCCTAGTGAGTGTGGG + Intronic
1059546736 9:115183471-115183493 AAATGGACCCTTCTGGGCCAAGG - Intronic
1059563515 9:115359061-115359083 ACATGGAAACTTGTGGGGGGTGG - Intronic
1060062568 9:120474337-120474359 AAATGTCCCCTGGCGGGTGGGGG - Intronic
1060480392 9:124013794-124013816 AAATGGGCCTTTTGGGGTGGGGG + Intronic
1061513062 9:131072552-131072574 AAGGGGACCCCTGGGGGTGGGGG + Intronic
1062283069 9:135760463-135760485 GAGGGGACCCCTGTGGGTGGTGG + Intronic
1062715194 9:138006684-138006706 ACATGCACTCATGTGGGTGGGGG + Intronic
1202780854 9_KI270717v1_random:35516-35538 AAATGCAACCTTGGAGGTGGTGG + Intergenic
1187393450 X:18901053-18901075 AAAGAGACCCCTGTGGCTGGTGG + Intronic
1195332737 X:103818152-103818174 GAATGGACCCTTATGGGGGTTGG - Intergenic
1196045969 X:111256848-111256870 AAATGGAATGTTGTGGGGGGGGG - Intronic
1197658340 X:129142524-129142546 AATTGGTCCCTTTGGGGTGGTGG - Intergenic
1198083234 X:133259375-133259397 AAAAGGACTCATGGGGGTGGCGG + Intergenic
1198199251 X:134398935-134398957 AATTGCATCCTTGTGAGTGGAGG + Intronic
1200173870 X:154098056-154098078 TAATGGACCCTTGCGGATGCTGG + Intergenic
1200852404 Y:7898167-7898189 ACATGGACCCCTGTTGGGGGTGG - Intergenic