ID: 1050095371

View in Genome Browser
Species Human (GRCh38)
Location 9:2059414-2059436
Sequence CCTGGTATGGAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 16, 3: 43, 4: 517}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050095371_1050095380 -2 Left 1050095371 9:2059414-2059436 CCTGCCTCCCTCTCCATACCAGG 0: 1
1: 0
2: 16
3: 43
4: 517
Right 1050095380 9:2059435-2059457 GGGAGAGAGGACTGTCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050095371 Original CRISPR CCTGGTATGGAGAGGGAGGC AGG (reversed) Intronic
900091383 1:922226-922248 AGTGATTTGGAGAGGGAGGCTGG - Intergenic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900431690 1:2605812-2605834 GCTGGACTGGAGAGGGTGGCGGG + Intronic
900623132 1:3596499-3596521 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623151 1:3596543-3596565 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623170 1:3596587-3596609 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623188 1:3596631-3596653 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900922492 1:5682237-5682259 CCTGGGATGGAGGGGGATGTTGG - Intergenic
900939186 1:5786906-5786928 GCTGGTGTGCAGAGGAAGGCAGG - Intergenic
901152559 1:7113487-7113509 CTAGGAATGGAGAGGGAGGAAGG + Intronic
901210961 1:7525854-7525876 CACGGTCTGAAGAGGGAGGCAGG + Intronic
901279866 1:8025983-8026005 TCTGGGATGGAGGGAGAGGCCGG - Intronic
901633019 1:10656997-10657019 CCTGGGATGGAAGGGAAGGCAGG + Intronic
901837728 1:11934946-11934968 CCTGGGCTGGAGAGGGAGTCTGG + Intronic
901896742 1:12319991-12320013 CCAGGTGAGGAGAGGGATGCAGG - Intronic
902892129 1:19452142-19452164 CATGGGATGGAGAGGGATGGAGG - Intronic
903243355 1:21998807-21998829 TCTGGGAAGGAGAGGGAGGGCGG - Intergenic
903280891 1:22249231-22249253 GCTGGAAGGGAGAGGGACGCAGG + Intergenic
903582884 1:24385365-24385387 ACTGCCATGGAGAGTGAGGCAGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903779904 1:25814488-25814510 CCTGGGATGGAAGGGGAGGGAGG + Intronic
903840186 1:26233633-26233655 CCAAGTTTGGGGAGGGAGGCAGG + Intergenic
904784137 1:32973052-32973074 CCAGGGAGGGAAAGGGAGGCTGG - Intergenic
905233562 1:36530296-36530318 CCTGGACTGGAGACTGAGGCAGG - Intergenic
905757932 1:40527493-40527515 CCTGTTATGGAGTGGGGGGAAGG + Intergenic
907384697 1:54118430-54118452 CCTGTTACAGAGTGGGAGGCAGG - Intergenic
912345209 1:108957361-108957383 CCTGGTTGGGAGAGGGCAGCTGG - Intronic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912517368 1:110224821-110224843 CCTGGTATGGGGAGGTGGACTGG + Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
914901559 1:151713932-151713954 CCAGGTATGCCCAGGGAGGCAGG - Intronic
915141197 1:153769692-153769714 GCTAGTATGGAGGGGGACGCAGG - Intronic
915156008 1:153876925-153876947 CCTGGTGAGGGGAGGGCGGCGGG + Intronic
915954037 1:160208322-160208344 GCTTGGAAGGAGAGGGAGGCAGG + Intronic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
916715315 1:167442638-167442660 GCTGGCATGGAGGGGTAGGCAGG - Intronic
918243786 1:182642022-182642044 CCAGGTATGGAAAAGGTGGCTGG - Intergenic
919699228 1:200614161-200614183 AGTGGTATGGAGAGGGAGGGTGG - Intronic
920181036 1:204131809-204131831 CCTGGCCTGGGGAAGGAGGCGGG - Exonic
920773007 1:208907344-208907366 CTAGGGATGGAGAGAGAGGCAGG + Intergenic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921177699 1:212608473-212608495 CCTGATATGGAGAGAGAGGGCGG + Intronic
921305105 1:213788533-213788555 CAGGGTATGGGGAGGGAGTCAGG - Intergenic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
922147909 1:222966956-222966978 CCTGGTATGGAGTGGGAGGGAGG + Intronic
922576273 1:226662937-226662959 TCTGGTCAGGAGAGGGAAGCTGG - Intronic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
923035911 1:230285041-230285063 CATGGCATGGCGAGGGGGGCGGG + Intergenic
924337608 1:242999266-242999288 CGTGGGATGGAGAGAGAGGAGGG - Intergenic
924370770 1:243347989-243348011 CCTGGGTTGGTGAGGGAGGAGGG - Intronic
924776178 1:247115556-247115578 CCTGGGATGGTCAGGTAGGCGGG - Intergenic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1063120924 10:3105273-3105295 CCAGGTATGAAGCGGGATGCCGG - Intronic
1063434658 10:6020204-6020226 CCAGGACTGGGGAGGGAGGCTGG - Intronic
1064086277 10:12349011-12349033 GCTGGGATGGAGGCGGAGGCGGG - Intergenic
1064249229 10:13694039-13694061 ACTGGAATGGAAAGGGAAGCAGG + Exonic
1064880511 10:20047651-20047673 CCATGTAAGGAAAGGGAGGCTGG - Intronic
1065479376 10:26177119-26177141 GTTGGTATAGAGAGGGGGGCTGG + Intronic
1067157534 10:43794580-43794602 CCAGGGCTGGAGAGTGAGGCCGG + Intergenic
1067261271 10:44694327-44694349 GCTGGGAAGGAGAGGGAGACAGG - Intergenic
1067375864 10:45727312-45727334 GCTGGGATGGTGAGGGCGGCGGG + Exonic
1067942433 10:50668113-50668135 TCGGGAATGGAGTGGGAGGCAGG - Intergenic
1068830674 10:61491272-61491294 GCAGGGAGGGAGAGGGAGGCAGG + Intergenic
1070240381 10:74674292-74674314 GCTGGTGTGGAGAGGGAGCAGGG - Intronic
1070476954 10:76838179-76838201 CCTGTCATGGGGAGGGGGGCAGG + Intergenic
1070673728 10:78397514-78397536 CAGGGTATGGAGAGCCAGGCAGG + Intergenic
1070798738 10:79232583-79232605 CCTGGTACGATGAGGGATGCTGG - Intronic
1070863677 10:79693071-79693093 TCGGGAATGGAGTGGGAGGCAGG - Intergenic
1070921071 10:80186708-80186730 CCTGGTCTGGAGAGGCAGGCAGG - Intronic
1071115507 10:82214407-82214429 CCTGATATGGTGAGGAAGGCAGG + Intronic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1072434542 10:95403255-95403277 TCTGCTACAGAGAGGGAGGCTGG + Intronic
1072808979 10:98445259-98445281 CCTGGGGAGGACAGGGAGGCAGG - Intronic
1073034303 10:100552576-100552598 GCAGCTCTGGAGAGGGAGGCTGG - Exonic
1074179790 10:111049108-111049130 CCTGTTATGGGGTGGGAGGAGGG + Intergenic
1074715618 10:116215874-116215896 GCTGGTGGGGAGAGGGAGCCGGG - Intronic
1074756324 10:116627060-116627082 CGTGGCATGGAGAGGCAGCCTGG + Intronic
1075643103 10:124079569-124079591 CCTGGGATGGAGAGGCAGCCTGG + Intronic
1075787094 10:125057403-125057425 CCTGTTGTTTAGAGGGAGGCGGG - Intronic
1075913461 10:126146273-126146295 CCTGTGAGGGAGAGGCAGGCAGG + Intronic
1076504076 10:130960435-130960457 GCTGCTATGGAGAGGGAATCTGG + Intergenic
1076823723 10:132956644-132956666 CCTGTTGTGGGGAGGGAGGAGGG + Intergenic
1076829999 10:132989234-132989256 CCTGGTGTGGAGCTGGTGGCGGG + Intergenic
1076888167 10:133272003-133272025 CCTGGTGGGGTGAGGGTGGCAGG - Intronic
1076903386 10:133350730-133350752 CCTGGGATGGATCGGGAGGAAGG + Intronic
1076993049 11:285487-285509 CCAGGTGTGGAGAGAGGGGCAGG - Intergenic
1077219936 11:1411362-1411384 CCTAGTTTGGGGAGGGAGCCTGG + Exonic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1078068431 11:8093155-8093177 CCTGCTCTGACGAGGGAGGCAGG + Intronic
1078434973 11:11316849-11316871 TCCTGTCTGGAGAGGGAGGCAGG - Intronic
1078646886 11:13148802-13148824 CCTGGAAAAGAAAGGGAGGCTGG + Intergenic
1078875296 11:15388882-15388904 CCTGTTAGGGGGTGGGAGGCTGG - Intergenic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1080690130 11:34549490-34549512 CCTGGTGTGGGGAGGCATGCCGG + Intergenic
1081675332 11:44965274-44965296 CCTGGTATGAGGAGGGAGGCTGG + Intergenic
1083378039 11:62242146-62242168 CCTGGGAAGGAGAGGTGGGCTGG + Intergenic
1083478770 11:62930250-62930272 ACTGCTCTGGAGAGGAAGGCTGG - Intergenic
1083729144 11:64643538-64643560 GCTGGAAGGGAGAGGGAGGGAGG + Intronic
1084178977 11:67437300-67437322 CCTGGGGTGGTGGGGGAGGCTGG - Intronic
1084653010 11:70500059-70500081 GCTGGTGTGGAGTGGGAGACTGG - Intronic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085259235 11:75194690-75194712 CCTGGTCTGAGGAGGGAGCCAGG + Intronic
1085960573 11:81456749-81456771 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1086864051 11:91958850-91958872 ACTGGAATGGTGAGGGAGGGAGG + Intergenic
1087689188 11:101299457-101299479 TCTGGGAAGGAGAGGGAGGTGGG - Intergenic
1088186790 11:107179265-107179287 TCTGTTATGGTGAGGGAGGAAGG - Intergenic
1088645662 11:111914129-111914151 GCTGGGATGGGGAGGGAGGGAGG + Intronic
1088693436 11:112346662-112346684 CATGGCCTGGTGAGGGAGGCAGG - Intergenic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1088893372 11:114060863-114060885 CCTGGGTCGGAGAGGGAGGGCGG + Intronic
1089152459 11:116374511-116374533 CCTGGGATGGGGAGGAAGTCTGG - Intergenic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1089555068 11:119311693-119311715 TCTGGTGCGGAGGGGGAGGCAGG - Intronic
1089617987 11:119705938-119705960 CCTGGGCCTGAGAGGGAGGCGGG + Intronic
1089916703 11:122164191-122164213 CCTTGTAGCGAGAGGGAGCCTGG - Intergenic
1090502350 11:127273685-127273707 CCAGGTCTGGAGAGGCAGGAGGG + Intergenic
1090660815 11:128880493-128880515 GGTGGTATGGAGTGGGAGGGTGG + Intergenic
1092237580 12:6819647-6819669 GCTGGCATGGAGGGTGAGGCTGG + Exonic
1093085333 12:14861194-14861216 CCTGTCATGGGGTGGGAGGCAGG - Intronic
1093706391 12:22279339-22279361 CTTGGTATGGGCTGGGAGGCAGG - Intronic
1094073339 12:26444476-26444498 CCTGGCATGGAGTTGGAGGCAGG - Intronic
1096435131 12:51583387-51583409 CCTGTTGTGGGGTGGGAGGCTGG + Intergenic
1096771426 12:53938483-53938505 CCAGGGAGGGAGAGGGAGGGGGG - Intergenic
1097249889 12:57626687-57626709 CCTGGCAGGGACAAGGAGGCAGG + Exonic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1101702795 12:107191034-107191056 CCTGTTGTGGAGTGGGAGGAGGG + Intergenic
1102758515 12:115365096-115365118 CTTGGCCTGGAGAGTGAGGCAGG - Intergenic
1102826523 12:115951767-115951789 CCTGGTATGGATAGTGAAGAGGG - Intergenic
1103724358 12:122990399-122990421 CCTGGTGGGTAGAGGGAGGGAGG - Intronic
1104684070 12:130772843-130772865 CCAGTCATGGAGAGGCAGGCAGG + Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106760466 13:32862586-32862608 CCTGATAAGAAAAGGGAGGCTGG + Intergenic
1107058536 13:36131352-36131374 CCTCCTCTGGAGAGAGAGGCTGG - Intergenic
1107428638 13:40318613-40318635 GCTGGCATGGAGAGGGACACCGG - Intergenic
1108640833 13:52380938-52380960 TCTGGCATAGTGAGGGAGGCTGG - Intronic
1108715263 13:53072380-53072402 CCTGGTGTGGAGATTGAGGAAGG + Intergenic
1108716854 13:53088655-53088677 ACTGGTAGGAAGAGGGAGGCAGG + Intergenic
1111834461 13:93370629-93370651 CCTGTTATGGAGGAAGAGGCTGG + Intronic
1112002257 13:95221898-95221920 ACAGGTGTGGAGAGGGAGGCTGG - Intronic
1112917935 13:104574059-104574081 CATGGGATGGAGAGTGAGGGAGG + Intergenic
1113447062 13:110377450-110377472 CCTGGGATGGAGATGGATACAGG - Intronic
1113486087 13:110653173-110653195 CCTGGGGTGGGGAGGGGGGCTGG + Intronic
1114374781 14:22132621-22132643 CCTTGTATGGAGACGGGAGCAGG - Intergenic
1114483615 14:23049760-23049782 CCTTGTATGGAGTGGGCTGCTGG + Intronic
1114527384 14:23375376-23375398 CCTGGGACCGTGAGGGAGGCAGG - Intronic
1114568188 14:23647585-23647607 CCTGGAAAGGAGCGGGAGCCTGG - Intergenic
1114672541 14:24419161-24419183 CCAGGGAGGGAGAGTGAGGCTGG - Exonic
1114847237 14:26337858-26337880 CCAGGTTTGGAGATGGAGGCAGG + Intergenic
1115767356 14:36637111-36637133 CCTGTTGTGGGGTGGGAGGCTGG - Intergenic
1117163774 14:53014394-53014416 CCAGTTATGGAGAGGTAGCCAGG + Intergenic
1117636197 14:57746076-57746098 CCTGTCATGGAGTGGGGGGCAGG + Intronic
1118731361 14:68669350-68669372 CGTGCTCTGGAGAGGGAAGCAGG - Intronic
1118845761 14:69546916-69546938 CCTGGTTTGGAGAGAGACCCGGG + Intergenic
1119881128 14:78100838-78100860 ACTGGAAAGGAGAGAGAGGCTGG - Intergenic
1120182813 14:81363060-81363082 CCTGGTATACTGTGGGAGGCTGG - Intronic
1120865784 14:89294195-89294217 CCTGCTGTGGGGAGAGAGGCTGG - Intronic
1121231035 14:92358610-92358632 GCAGGTATGGAGAGGGGTGCAGG - Intronic
1121427918 14:93865938-93865960 CCTGGAAGGGAGATGGAGGCGGG - Intergenic
1122070124 14:99200698-99200720 CCTGGCATGGCGCAGGAGGCTGG + Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122779787 14:104138775-104138797 CCCGGCCTGGAGAGGGAGGCGGG + Intronic
1122954883 14:105065985-105066007 CCATGTAGGAAGAGGGAGGCGGG - Intergenic
1123004883 14:105316357-105316379 CCTGGAATGGAGAAGCAGCCAGG - Intronic
1123048964 14:105531513-105531535 CCTGGCATGGAGAGAGAAGAGGG + Intergenic
1123064943 14:105613594-105613616 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123069144 14:105633047-105633069 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123074244 14:105659237-105659259 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123088241 14:105728820-105728842 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123094200 14:105758190-105758212 CCTGGTGAGGAGTGGGATGCCGG - Intergenic
1124075398 15:26439107-26439129 CCTGGTAAGGAGAGGGAGATGGG - Intergenic
1124687160 15:31792421-31792443 GATGCTATGGAGAGGGCGGCAGG - Intronic
1125331471 15:38586705-38586727 CCTGTTATGGGGTGGGAGGAGGG + Intergenic
1125766135 15:42137750-42137772 CCGGGTGGGGAGAGGCAGGCAGG - Intergenic
1126820228 15:52495925-52495947 CCTGGCGTGGGGTGGGAGGCAGG + Intronic
1128532241 15:68462337-68462359 CCTGTTGAGGAGAGAGAGGCAGG - Intergenic
1129029008 15:72605196-72605218 GGTGGTGTGGGGAGGGAGGCGGG - Intergenic
1129281899 15:74491934-74491956 CGTGGTGTGGAGAGGGGGACTGG + Intergenic
1129743063 15:77999551-77999573 CCTGGTCTGCAGAGCCAGGCAGG - Intronic
1129838210 15:78727190-78727212 CGTGGGGTGGGGAGGGAGGCAGG - Intronic
1129858129 15:78839661-78839683 CCTGGTATGGAGAAAGAGAATGG + Intronic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130143540 15:81253916-81253938 CCTGATATGGAGGGGAAGGTTGG - Intronic
1130256303 15:82327584-82327606 CCTGCCATGGAGAGGGCAGCTGG - Intergenic
1130353166 15:83108548-83108570 CCTGCAGTGGAGTGGGAGGCAGG - Intronic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1130598648 15:85262404-85262426 CCTGCCATGGAGAGGGCAGCTGG + Intergenic
1132926577 16:2432842-2432864 CTTGGGATGGCGAGGGAGACAGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135932180 16:26747610-26747632 AGTGGGATGGAGAGGGAGGGGGG - Intergenic
1135992255 16:27225203-27225225 CCTGAGAAGGAGAGGGAGTCTGG - Exonic
1137371152 16:47906959-47906981 AATGGAATGGAAAGGGAGGCAGG + Intergenic
1138104542 16:54280820-54280842 GATGGTATGGAGAAGCAGGCGGG - Intergenic
1139747037 16:69083054-69083076 CTTGGGTTGGAGAAGGAGGCAGG - Intronic
1140888263 16:79263174-79263196 CCTGGTATATCTAGGGAGGCCGG + Intergenic
1141429038 16:83961474-83961496 CTTGGAATGGAATGGGAGGCAGG + Intronic
1141563430 16:84885432-84885454 CCTGGTTCAGACAGGGAGGCCGG + Intronic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142172761 16:88631472-88631494 TCTGCTCTGGGGAGGGAGGCTGG - Exonic
1203141842 16_KI270728v1_random:1771910-1771932 CCTGGGATTGAGATGGAGGAAGG - Intergenic
1143027826 17:3951468-3951490 CCTGGGATGGAGGTGGAAGCAGG + Intronic
1143447595 17:7018455-7018477 CATGGTTGGGAGAGGGGGGCCGG + Intergenic
1143561455 17:7697977-7697999 CCTGTTTGGGAGAGTGAGGCAGG - Intronic
1143646328 17:8232548-8232570 CCTGGGATGGGTAGTGAGGCCGG - Intronic
1144334318 17:14255398-14255420 CCAGGGATGGGGAGGAAGGCAGG - Intergenic
1144731081 17:17526666-17526688 CCTGGCGTGGAGACAGAGGCCGG - Intronic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145778076 17:27543361-27543383 CCAGCTATGGAGAGGCAGGTTGG + Intronic
1146354859 17:32125446-32125468 CCTGGTTTGGAGAAGTGGGCAGG - Intergenic
1146491719 17:33288109-33288131 TCTGGTCTGGAGGGGGAGACAGG + Intronic
1146602987 17:34234765-34234787 CCAGGTATGGTGAGGGAGGCTGG - Intergenic
1146688612 17:34857702-34857724 CCTGGTGGGAAGAGGCAGGCAGG + Intergenic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147563768 17:41524360-41524382 CCGGGTAGGTAGAGGGAAGCAGG - Exonic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1148579667 17:48734843-48734865 CCAGGTTTGGAGAAGGGGGCTGG - Intergenic
1148791612 17:50176354-50176376 CTAGATATGGAGAGCGAGGCCGG + Intergenic
1149143803 17:53465671-53465693 CTTGGTAGGGAGAGGTAGACAGG + Intergenic
1149774496 17:59346517-59346539 CCTTGCTTGGAGAGGGAGGGAGG + Intronic
1149776921 17:59365509-59365531 CCTGGCCTGGAGAGTGAAGCTGG + Intronic
1149842618 17:59979322-59979344 CCTGGTATTGAGAGCCAGGATGG - Intergenic
1150224209 17:63514156-63514178 TCAGGTGTGGAGAGGGAGCCTGG - Intronic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1150615104 17:66764370-66764392 CCTGGTAGAGAGTGGAAGGCTGG + Intronic
1151404142 17:73875982-73876004 CCTTGAATGGATAGAGAGGCAGG - Intergenic
1151573311 17:74938017-74938039 CCTGGGTTGGTGTGGGAGGCAGG + Intronic
1151755945 17:76075294-76075316 CGGGGGATGGAGCGGGAGGCGGG + Intronic
1151955210 17:77376696-77376718 CCTGGCATGGGGAAAGAGGCAGG + Intronic
1152522248 17:80863298-80863320 CCTGGCATGGGGAGTGATGCTGG - Intronic
1152730601 17:81967823-81967845 CCTGGACAGGTGAGGGAGGCTGG + Intergenic
1154121364 18:11655082-11655104 CCCAGTTTGGAGAAGGAGGCCGG + Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1155415797 18:25598000-25598022 CCTGCTCTAGAGAAGGAGGCAGG - Intergenic
1155594072 18:27462264-27462286 CCTGCTCTGGAGCTGGAGGCAGG - Intergenic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1156605752 18:38665064-38665086 CCTGGTATGGAGAGTTATGGTGG + Intergenic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1158070633 18:53466164-53466186 CCTGTTATGGAGGCCGAGGCAGG - Intronic
1158342865 18:56485546-56485568 CCTGTTGTGGGGTGGGAGGCTGG - Intergenic
1158427134 18:57350727-57350749 CATGCTATGGAGAGGCAGCCTGG - Intergenic
1158570830 18:58595833-58595855 GCTGGTCTGGAGAGGGAGCTGGG + Intronic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161428271 19:4216399-4216421 CCAGGTAGGGAAAGTGAGGCTGG + Exonic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1164395896 19:27862651-27862673 CCTGTTATGGGGTGGGAGGAGGG - Intergenic
1164568916 19:29354305-29354327 CCTGTTATGGGGTGGGAGGAGGG + Intergenic
1164854608 19:31511309-31511331 CCTGGGTTGGAGAGGGAGAGAGG - Intergenic
1165450819 19:35881286-35881308 CCTTGAATAGAAAGGGAGGCAGG - Intergenic
1165824220 19:38696472-38696494 CCGGGTAGGGAGAGGAAGGATGG + Intronic
1166777403 19:45321571-45321593 CCTGGCATGGAGTTGGAGCCTGG + Intronic
1166835322 19:45664183-45664205 CCTGGAGTGGAGAGGGAAGGGGG - Intergenic
1167440924 19:49508382-49508404 ACTCCTTTGGAGAGGGAGGCAGG + Intronic
1168290099 19:55353393-55353415 GCTGGAATGGAGAGGGAGAAGGG + Exonic
1168333035 19:55580607-55580629 CCTGGACTCGGGAGGGAGGCTGG + Intronic
925080138 2:1056738-1056760 CCTGCTGTGGGGAGGGAGGGAGG + Intronic
925886134 2:8394905-8394927 CATGCTATGTAGAGGTAGGCAGG - Intergenic
925969571 2:9096930-9096952 CCGGGTGTGGAGCGGGAGGGTGG + Intergenic
926996092 2:18737219-18737241 CCTGTTGGGGGGAGGGAGGCTGG + Intergenic
927194764 2:20539746-20539768 CCAGGTATGGAGAGGGACAGAGG - Intergenic
927466137 2:23338097-23338119 GCTGGTGTGGAGAGGGAGAGTGG + Intergenic
927721332 2:25384530-25384552 CCTGGTATGGTCAAGCAGGCTGG + Intronic
927879315 2:26679545-26679567 GCTGGGCTGGAGAGGTAGGCAGG + Intergenic
929882796 2:45851904-45851926 CCTGCCATGGAGAGGCAGGTGGG + Intronic
932369656 2:71176597-71176619 GCTGGCATAGAGAGGGAGTCAGG - Intergenic
932416905 2:71579076-71579098 TGTGGGGTGGAGAGGGAGGCTGG - Intronic
933782273 2:85811012-85811034 CCTGGCAGGGAGAGGGGTGCTGG + Intergenic
934615702 2:95769361-95769383 CCCAGTATGGGGAGAGAGGCTGG + Intergenic
936572071 2:113625804-113625826 CTTGGAATAGAAAGGGAGGCAGG - Intergenic
938821055 2:134960573-134960595 GCTGGTAAGGAGAGGGAAGCTGG - Intergenic
940996367 2:160154426-160154448 CCTGTTATGGGGTGGGGGGCTGG + Intronic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
942172333 2:173300355-173300377 TCTGCTGTGGAGAGGGAGCCTGG + Intergenic
942575562 2:177360019-177360041 ACTGGTATGGTGAGGGTGGTTGG - Intronic
943584128 2:189717930-189717952 CCTGTTCTGGGGTGGGAGGCAGG + Intronic
943945225 2:194052306-194052328 CCTGTCATGGAGTGGGGGGCAGG + Intergenic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
944997198 2:205307083-205307105 CTTGGTGAGGAAAGGGAGGCAGG - Intronic
945123537 2:206484255-206484277 GTTGGGATGGAGAGGGAGGTTGG + Intronic
945318722 2:208397148-208397170 CCTGTTGTGGGGTGGGAGGCTGG + Intronic
946028793 2:216689232-216689254 CCTGATGTGGAGAGGCAGGCAGG - Intronic
947141949 2:227027470-227027492 CCTGTTGTGGAGTGGGAGGAGGG + Intronic
947228918 2:227866113-227866135 CCTGCTGTGGGGATGGAGGCAGG + Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947709987 2:232307948-232307970 CCTGGCATGGAGAGAAAGGCAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948922937 2:241074291-241074313 CCTTGTATGGTGAGGGCGGGGGG - Intronic
948979112 2:241483748-241483770 CCTGGAATGAAGAAGGAGGCTGG - Intronic
948980944 2:241494460-241494482 CCTGCTCTGGGGAGAGAGGCAGG - Exonic
1169393818 20:5212585-5212607 CCTGGCATGGACACAGAGGCCGG - Intergenic
1170391158 20:15876262-15876284 CCTGCTATTGGGTGGGAGGCAGG - Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1171320164 20:24236035-24236057 CTGGGGATGGAGAGGCAGGCAGG + Intergenic
1171987399 20:31670186-31670208 GCTAGGATGGAGAGGGAGACAGG - Intronic
1172149019 20:32777634-32777656 CCTGGCATAGAGTGGGAGGTGGG - Intronic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172502352 20:35436453-35436475 CCTAGTGTGAAGAGGGAGGTGGG - Intronic
1172681205 20:36716730-36716752 CCTAGTAGGTAGAGGAAGGCAGG + Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1173108180 20:40158244-40158266 CCTGCTATACTGAGGGAGGCAGG - Intergenic
1174196302 20:48775090-48775112 CCTGGTGTGGTCAGGGATGCAGG - Intronic
1174286816 20:49480001-49480023 GCTGAAATGGGGAGGGAGGCAGG - Intronic
1174358868 20:50015561-50015583 CCTGGTCTGGAAACGGAGGCGGG - Intergenic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1174553013 20:51375082-51375104 CCAGGTATTGCGAGGGAGGGTGG + Intergenic
1175575721 20:60058991-60059013 CCTGGTGTGGGGAGGAAGCCGGG + Intronic
1175870756 20:62208398-62208420 CCTGGTAGGGGGCGGCAGGCTGG - Intergenic
1175890866 20:62315379-62315401 CCTGGCATGGAGGGGGCGTCTGG - Intronic
1177859991 21:26441056-26441078 TCTGCTATGGAGAGGGGAGCTGG + Intergenic
1177894971 21:26846427-26846449 CCTGGTAGGAAGAGGAAGGAGGG - Intergenic
1178402285 21:32297283-32297305 CCTGGAAAGGGGAGAGAGGCTGG + Intronic
1179149369 21:38796852-38796874 CCTGGAAGGGAGAGAGAGGGAGG - Intergenic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179961178 21:44767677-44767699 CCTGGGATGGGGAGGGCTGCTGG - Intergenic
1180200419 21:46220749-46220771 CCGGGCATGGAGAGGTAGCCAGG + Intronic
1180698323 22:17768424-17768446 CCTGGGCAGGGGAGGGAGGCAGG - Intronic
1181447808 22:22991882-22991904 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1181851832 22:25754971-25754993 CCTGGGCTGGAGAGGAAGGCGGG + Intronic
1181904605 22:26184347-26184369 AGTGGGGTGGAGAGGGAGGCAGG - Intronic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1183362236 22:37388786-37388808 TCTGGGATAGAGAGTGAGGCGGG - Intronic
1183363834 22:37396876-37396898 CCTGGCATGGACTTGGAGGCTGG - Intronic
1183453885 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183781283 22:40000544-40000566 CCTGGTATGGAGAAGGCGCTTGG - Intronic
1184523399 22:45008498-45008520 CCTGGGATGGGGCGGGAGGGTGG - Intronic
1184696621 22:46142992-46143014 CCTGGTGTGATGAGGGAGGCAGG + Intergenic
1184723423 22:46329158-46329180 GCGGGTATGGACAGGGAGGTGGG + Intronic
1185072906 22:48667037-48667059 CCTGGGATTGAGGGGGAGGAGGG + Intronic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1185118023 22:48949119-48949141 GCTGGAATGGGGGGGGAGGCTGG - Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185344249 22:50304486-50304508 CCTGGTAGGCAGAGAAAGGCAGG + Intronic
1185405017 22:50642702-50642724 ACTGGCAGGGAGAGGAAGGCAGG + Intergenic
1185428120 22:50785076-50785098 CTTGGAATAGAAAGGGAGGCAGG + Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
950190067 3:10970471-10970493 GGTGGGATGGAGAGAGAGGCTGG + Intergenic
950492477 3:13314436-13314458 GCTGCAATGGAGAGTGAGGCTGG + Intergenic
950939923 3:16883337-16883359 CCTGGGATGGAGAGGTGGGTGGG + Intronic
951202298 3:19889119-19889141 CCTGGTAAGTAGGGGGAGGAGGG + Intronic
952043284 3:29285654-29285676 CCTGGTATGAAGAAGGGGCCAGG + Intronic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954181021 3:48881474-48881496 CCTGGGATGGAGATGGGGGTGGG - Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954866198 3:53732079-53732101 CCAGGTATGGTGGCGGAGGCCGG + Exonic
955479225 3:59372355-59372377 CCAGGCATTGAGAGAGAGGCTGG + Intergenic
955735188 3:62031463-62031485 CATGATATGGAGAGGTAGACAGG + Intronic
956114512 3:65904749-65904771 TCTAGTGAGGAGAGGGAGGCAGG - Intronic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960245405 3:115394702-115394724 TATAGGATGGAGAGGGAGGCAGG - Intergenic
960846233 3:122006696-122006718 CCAGGAATGGACAGGGAGGCAGG + Intronic
961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG + Intronic
961110792 3:124281426-124281448 CCTAGAATGGAGAGTGAGACTGG + Intronic
961539577 3:127590510-127590532 CCTGGTCTGGCGCTGGAGGCCGG - Exonic
962201115 3:133401855-133401877 CCTGGGATGAAGTGGGAGGCAGG - Intronic
962249725 3:133828629-133828651 GGTGGGATGGGGAGGGAGGCTGG - Exonic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
963069925 3:141295688-141295710 CCTGTTGTGGAGTGGGGGGCTGG - Intergenic
963159428 3:142135553-142135575 CCTGTCATGGGGTGGGAGGCTGG - Intronic
967194968 3:187018120-187018142 GCTGAGATGGAGAGGCAGGCTGG + Intronic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968512393 4:1001324-1001346 CCTGATGTGGGGCGGGAGGCTGG + Intronic
968666028 4:1822836-1822858 CCTGGAGTGGTCAGGGAGGCAGG - Intronic
968731619 4:2271801-2271823 CGGGGTATGGTGAGGGAGGCGGG + Intronic
968881298 4:3301562-3301584 CCAGGGATGGAGAGTGAGGCCGG + Intronic
968881311 4:3301595-3301617 CCGGGGATGGAGAGTGAGGCCGG + Intronic
968881324 4:3301628-3301650 CCGGGGATGGACAGTGAGGCCGG + Intronic
968881336 4:3301661-3301683 CTGGGGATGGAGAGTGAGGCCGG + Intronic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969239450 4:5889118-5889140 GCTAGGATGGAGAGGGTGGCAGG - Intronic
969271229 4:6104781-6104803 CCTGGAGTGAAGGGGGAGGCTGG - Intronic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
971026526 4:22594216-22594238 CCTGTTCTGGAGAGGGATGAAGG - Intergenic
971390541 4:26181428-26181450 GGAGGTATGGAGAGGGAGGAAGG - Intronic
971864841 4:32156298-32156320 CCTGTTGTGGGGAGGGAGGAGGG - Intergenic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973607279 4:52600315-52600337 CCTGGCATGGAAGGGAAGGCAGG + Intronic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976072212 4:81254439-81254461 ACAGGAAGGGAGAGGGAGGCGGG - Intergenic
976807436 4:89063613-89063635 CCTGCTAGGGCCAGGGAGGCTGG - Intronic
977454827 4:97246035-97246057 ACTGGTTTGGGGAGGGTGGCAGG - Intronic
977616605 4:99094085-99094107 CCTGTTGTGGGGTGGGAGGCGGG - Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981344079 4:143655012-143655034 CCTGGTGTGGAAATGGAGGATGG - Intronic
981660643 4:147162680-147162702 GTTGTTATGGAGAGGGAGTCTGG - Intergenic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
982696486 4:158608113-158608135 ACTGTCATGGACAGGGAGGCTGG - Intronic
982724022 4:158886451-158886473 AGTGGTCTGGAGAGGGTGGCAGG + Intronic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985788305 5:1911398-1911420 CCTTCTATGGATGGGGAGGCAGG - Intergenic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
989990151 5:50754331-50754353 CCTGTTGTGGGGTGGGAGGCTGG - Intronic
990919416 5:60945714-60945736 CCTGGACTGGCGACGGAGGCAGG + Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
994855958 5:105119209-105119231 CCTGATATGGAAATGGAGTCAGG - Intergenic
995369257 5:111400552-111400574 CATGGAATGGGGAGGGAGGGAGG - Intronic
995825977 5:116299882-116299904 CTTGGGATGGAGAGGAATGCTGG - Intronic
996421149 5:123264106-123264128 GCTACTATGGAGAGGAAGGCTGG + Intergenic
997240593 5:132303840-132303862 CCTGTTGTAGAGAGGTAGGCAGG - Intronic
997379420 5:133424662-133424684 GCTGGTCTGGACAGGGAAGCTGG + Intronic
997537224 5:134632404-134632426 CCTGGTAAGGTGAAGGTGGCGGG - Intronic
997981868 5:138472629-138472651 CCAGGTATGGAACTGGAGGCAGG + Intergenic
998003043 5:138639685-138639707 CCTGGTAGGGAGGGGGGAGCAGG - Intronic
998159998 5:139808079-139808101 TCTGCTCTGGAGAGGGATGCTGG - Intronic
999228724 5:150048831-150048853 CCTGGGCTAGGGAGGGAGGCTGG + Intronic
999684258 5:154088422-154088444 TCTGGTGTGGAGAAGGAGGGGGG - Intronic
1001089391 5:168726349-168726371 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089398 5:168726367-168726389 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089449 5:168726501-168726523 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1002282079 5:178136952-178136974 TCTGGTCTGGTGGGGGAGGCAGG + Intronic
1002419842 5:179139736-179139758 CCAGGTAGGGTGAGGCAGGCGGG + Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002934363 6:1659146-1659168 CCTGCTCTGTGGAGGGAGGCTGG + Intronic
1003133934 6:3418570-3418592 CCTGGTAGGGAGAGGAAGCCTGG + Intronic
1005121379 6:22392945-22392967 CCAGTGATGGAGAGGGAGCCTGG - Intergenic
1005714260 6:28532061-28532083 CCAGGGATGGAGAGAGAGTCTGG - Intronic
1005930463 6:30480597-30480619 CCTGGTGTGTGGAGGAAGGCTGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006871269 6:37254433-37254455 CCTGGAATGATGAGGGAGGGAGG - Intronic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1007778511 6:44237676-44237698 CCTGGTAAGGACGAGGAGGCGGG - Intergenic
1008775828 6:55036536-55036558 CCTGTTAGGGGGAGGGAGGCTGG - Intergenic
1009446961 6:63754340-63754362 CCTGTTGTGGAGTGGGGGGCTGG - Intronic
1011117549 6:83910350-83910372 ACTGGTGGAGAGAGGGAGGCTGG + Intronic
1011908305 6:92402171-92402193 CCTGTCATGGGGTGGGAGGCTGG - Intergenic
1012291852 6:97466072-97466094 ACTGGGATGGAGAGGGAAGTGGG - Intergenic
1012939384 6:105401564-105401586 GCTGGAATGGAGAAAGAGGCTGG - Intronic
1014575017 6:123059044-123059066 CCTGGAGGAGAGAGGGAGGCAGG - Intronic
1015300395 6:131646546-131646568 CCTAGTCTGGAGTGGGAGGCAGG + Intronic
1016286648 6:142481170-142481192 TCTGGGGAGGAGAGGGAGGCTGG + Intergenic
1017060932 6:150484333-150484355 CCTGGGATTTGGAGGGAGGCAGG - Intergenic
1017751676 6:157494427-157494449 TCTGGTCTGGAGAGGTAGACAGG + Intronic
1017901093 6:158719024-158719046 ACTGGGCTGGAGCGGGAGGCAGG - Intronic
1018301435 6:162406849-162406871 ACTGGGGTGGGGAGGGAGGCAGG - Intronic
1019319595 7:409548-409570 TCTGTTAGGGAGGGGGAGGCTGG - Intergenic
1019520300 7:1457877-1457899 CCCGGAATGGGGAGGAAGGCAGG - Intronic
1019576393 7:1739677-1739699 GCTGGAGTGGAGAGGGCGGCAGG + Intronic
1019911068 7:4100789-4100811 CTGGGCCTGGAGAGGGAGGCTGG + Intronic
1020780060 7:12506634-12506656 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1021403597 7:20238069-20238091 CCTGGTCTGAAAAGGGAGGAGGG + Intergenic
1021436853 7:20628156-20628178 CCTGTTGTGGGGTGGGAGGCTGG - Intronic
1022247278 7:28572597-28572619 GGTGGCAGGGAGAGGGAGGCAGG - Intronic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1022516478 7:30977976-30977998 CCTGCTCTGGGGAGAGAGGCGGG + Intronic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1024665833 7:51546170-51546192 CCTGGTATGGAGTAGGAAGAGGG - Intergenic
1026829868 7:73603882-73603904 TGTGGTCAGGAGAGGGAGGCAGG + Intronic
1028189955 7:87835707-87835729 GCGGGGAAGGAGAGGGAGGCGGG + Exonic
1028984150 7:96996892-96996914 TCTGGGATGGGGAGGGAGGCAGG - Intergenic
1029537327 7:101164147-101164169 CCTGGAATTGAGAGGGGGCCGGG + Exonic
1030019372 7:105257993-105258015 CCTACTCTGGAGGGGGAGGCAGG + Intronic
1031118764 7:117696803-117696825 CTTGGTTTGGAGAGGAAGGGAGG + Intronic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1033068845 7:138182993-138183015 CCCAGAATGGAGAGGGAGGAAGG + Intergenic
1033528373 7:142239699-142239721 GAAGGTATGGAGAGGGAGGGAGG + Intergenic
1034401150 7:150862504-150862526 CCAGGTAGGGAGATAGAGGCTGG + Intergenic
1034784217 7:153910466-153910488 CCTGGGCTGGAGAGGCAGCCAGG - Intronic
1034815770 7:154170698-154170720 CCTGGTATGGGAAGGGAAGGAGG + Intronic
1034936546 7:155203970-155203992 CCTGGGAAGGAAAGTGAGGCAGG + Intergenic
1035492613 7:159293536-159293558 GCTGGCATGCAGAGAGAGGCTGG + Intergenic
1035922693 8:3694619-3694641 CCTGGGCATGAGAGGGAGGCTGG + Intronic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036284884 8:7435537-7435559 CATGCTATGGAGAGAGAGCCAGG + Intergenic
1036336591 8:7875993-7876015 CATGCTATGGAGAGAGAGCCAGG - Intergenic
1037034812 8:14153382-14153404 ACTGGTATTCAGAGGTAGGCTGG - Intronic
1037150015 8:15626021-15626043 CCAGCTGTGGCGAGGGAGGCTGG + Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037654750 8:20873289-20873311 CATGCTAAGGAGAGAGAGGCTGG - Intergenic
1037801122 8:22036587-22036609 CCTGGTATGGAGAAGGGAACGGG + Intronic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1039140979 8:34387984-34388006 CCTGTTGTGGAGTGGGGGGCAGG - Intergenic
1039270599 8:35876041-35876063 CCTGGCCTGGAGAATGAGGCTGG + Intergenic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1040486583 8:47878487-47878509 CCTGGCATGGTGAAGGAGGGGGG - Intronic
1040531495 8:48269974-48269996 CCTGGTGAGGAGAGGAAGCCAGG + Intergenic
1040875784 8:52150572-52150594 GCGGGCAGGGAGAGGGAGGCAGG + Intronic
1041336105 8:56786131-56786153 CCTGGTATGGCTAGGGGGTCTGG + Intergenic
1041357879 8:57021243-57021265 CGTGGAAAGGAGAGGGAGACGGG - Intergenic
1041401938 8:57455511-57455533 CCTGGAATGGAGAGGCACTCAGG - Intergenic
1041750947 8:61260520-61260542 CCTGGTATGGAGAGGTGGAGAGG - Intronic
1042216451 8:66433090-66433112 CCTGGCATGTACAGGGAGTCAGG + Intronic
1042658789 8:71131363-71131385 ATTGGTATGGATAGAGAGGCAGG - Intergenic
1043364439 8:79516218-79516240 CCTGTTGTGGGGTGGGAGGCTGG - Intergenic
1044819720 8:96147445-96147467 CCTAGTTTGGGGAGAGAGGCAGG - Intronic
1045046313 8:98282251-98282273 GCTGGTCTGGAGAGGCAAGCAGG + Intronic
1045205545 8:100035951-100035973 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1048170839 8:132104708-132104730 GCAGGGATGGTGAGGGAGGCAGG + Intronic
1048256369 8:132907956-132907978 CCTGGTTTGGAGGATGAGGCAGG + Intronic
1048469732 8:134695852-134695874 CCTTGTTTAGAGAGGCAGGCAGG - Intronic
1049388541 8:142356365-142356387 CCTGGAATGGGGAGGTGGGCAGG + Intronic
1049404069 8:142443818-142443840 CCTGGTGTGGGGAGGGGTGCTGG + Intergenic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049555191 8:143278101-143278123 CATGGTCTGGAGAGGGTGGCGGG - Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050461724 9:5883002-5883024 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1051481633 9:17568404-17568426 CCTGTCATGGGGTGGGAGGCAGG - Intergenic
1052219135 9:25998351-25998373 CCAAGGATGGAGAGAGAGGCAGG - Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1055643488 9:78340621-78340643 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1055857440 9:80707232-80707254 TCTGGTGGGAAGAGGGAGGCTGG - Intergenic
1056409166 9:86308297-86308319 CCTGGTATGGACAATGAGACTGG + Intronic
1056547031 9:87621480-87621502 CCTGGGAAGGCCAGGGAGGCTGG - Intronic
1056581332 9:87889558-87889580 ACTGCTCTGGAGAGTGAGGCAGG - Intergenic
1056780382 9:89544602-89544624 TGTGATCTGGAGAGGGAGGCAGG - Intergenic
1057091684 9:92263741-92263763 TCAGGAATGGAGAAGGAGGCAGG + Intronic
1057964271 9:99488161-99488183 CTGGGGATGGAAAGGGAGGCGGG - Intergenic
1058317946 9:103592590-103592612 CCTGTTATGGGGTGGGAGGAGGG - Intergenic
1058455988 9:105138718-105138740 CCAGCTGTGGGGAGGGAGGCGGG - Intergenic
1058758181 9:108103150-108103172 ACTGGTATGGAGGGGGACTCTGG + Intergenic
1059299315 9:113299305-113299327 CCTGGTCTGGAAAGGTAGGGTGG + Exonic
1060325553 9:122611092-122611114 CGTGGTGTGGACAAGGAGGCAGG - Intergenic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1060520186 9:124290013-124290035 CCTGGTAAGGAGAGCGACACAGG + Intronic
1061130676 9:128706169-128706191 CCTGATATGATGACGGAGGCAGG + Intronic
1061503792 9:131019293-131019315 ACAGGTAGGGAGAGAGAGGCAGG - Intronic
1061670580 9:132185968-132185990 CCTGGTGTGGGGAAGGAGGAGGG + Intronic
1061901403 9:133674043-133674065 CCTGCCAAAGAGAGGGAGGCTGG + Intronic
1062322549 9:135997505-135997527 CCCGGAATGGAGAGGACGGCGGG - Intergenic
1185836196 X:3347204-3347226 TCTGGCAAGGGGAGGGAGGCGGG - Intergenic
1186726262 X:12362354-12362376 CCTGTCATGGAGTGGGAGGAGGG - Intronic
1189893070 X:45625786-45625808 CCTGTTGTGGGGAGGGGGGCTGG - Intergenic
1190536845 X:51437456-51437478 CCTGGAATGGATAGAGAGGTAGG + Intergenic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1191762105 X:64657068-64657090 GGTGGTATGGAGAGGGAGAATGG - Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192432520 X:71121989-71122011 CTTGGAAGGGAGAGAGAGGCTGG - Intronic
1193150429 X:78118818-78118840 TCTGGTAGGGAGGGGGAGCCAGG + Intronic
1194503642 X:94707331-94707353 CCTTGAATGGAATGGGAGGCAGG + Intergenic
1195572588 X:106412999-106413021 CCTGTCATGGGGTGGGAGGCGGG + Intergenic
1195702420 X:107715459-107715481 CCTGGTAAGGAGAGGGACAGGGG + Intronic
1196398210 X:115288579-115288601 CCGGGTGTGGTGAGGGAGGAAGG + Intergenic
1197490291 X:127107882-127107904 CCTGTCATGGTGTGGGAGGCTGG + Intergenic
1197654306 X:129099672-129099694 CACGATATGTAGAGGGAGGCAGG - Intergenic
1197750629 X:129961376-129961398 CCAGGTATAGTGAGGGAGTCCGG - Intergenic
1198119577 X:133578867-133578889 TCTGCTATGGAGAGGGATGGGGG + Intronic
1198177529 X:134171849-134171871 CCGGGAATGGAGGGGGAGGGAGG - Intergenic
1199901853 X:152181664-152181686 CCTGTTGTGGGGTGGGAGGCTGG + Intronic
1200159180 X:153996206-153996228 CCTTGAATAGAGTGGGAGGCAGG - Intergenic
1200247151 X:154532290-154532312 CATGGTATGGCTTGGGAGGCCGG + Intronic
1202366278 Y:24168200-24168222 CGTGGGGTGGGGAGGGAGGCGGG - Intergenic
1202504503 Y:25501923-25501945 CGTGGGGTGGGGAGGGAGGCGGG + Intergenic