ID: 1050101274

View in Genome Browser
Species Human (GRCh38)
Location 9:2122726-2122748
Sequence GGTTCTACCATACTGAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050101274_1050101281 30 Left 1050101274 9:2122726-2122748 CCCAATTTCAGTATGGTAGAACC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1050101281 9:2122779-2122801 ATTGATGGTCCATTTCATTGTGG No data
1050101274_1050101280 15 Left 1050101274 9:2122726-2122748 CCCAATTTCAGTATGGTAGAACC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG No data
1050101274_1050101278 -5 Left 1050101274 9:2122726-2122748 CCCAATTTCAGTATGGTAGAACC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1050101278 9:2122744-2122766 GAACCAAAGGAAGAAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050101274 Original CRISPR GGTTCTACCATACTGAAATT GGG (reversed) Intronic
900842424 1:5064607-5064629 GGTTGTGCCATACTGATACTTGG - Intergenic
905904235 1:41606540-41606562 GGTTCCACGTTACTGAAACTTGG + Intronic
906842006 1:49148943-49148965 GGTGCCAACATACTGAATTTGGG + Intronic
907751484 1:57267625-57267647 GGTTCTACCTTTCTGAATTTTGG + Intronic
907802486 1:57783934-57783956 GATACAACAATACTGAAATTAGG + Intronic
908004307 1:59712378-59712400 GGATCTACCATTCTGGAATCTGG + Intronic
908067273 1:60420484-60420506 GGCTCTACCACACAGACATTAGG + Intergenic
908729245 1:67208825-67208847 GGATCTACCATTCTGGAATCTGG - Intronic
909167377 1:72246672-72246694 GGCTCTACAATTCTGCAATTGGG + Intronic
910078444 1:83309132-83309154 GGTGCAACAATATTGAAATTGGG - Intergenic
910277899 1:85467414-85467436 TGTCTTTCCATACTGAAATTGGG + Intronic
912034025 1:105287922-105287944 GGTTATTCCTTATTGAAATTAGG - Intergenic
912102963 1:106234243-106234265 GGATCTACCATTCTGGGATTTGG - Intergenic
914677965 1:149918147-149918169 GGTCCTGCCATACTGAGACTGGG - Intergenic
915885709 1:159718616-159718638 GGTTCTACCATTCTGGGATCTGG - Intergenic
917515357 1:175702546-175702568 GGTTATCCCATGCTGAAATGGGG + Intronic
917807362 1:178625773-178625795 TGTTCTACTATATGGAAATTTGG + Intergenic
923014690 1:230117532-230117554 GATACCACGATACTGAAATTAGG - Intronic
1064836854 10:19542543-19542565 GGAACTACTATACTGCAATTTGG - Intronic
1065408176 10:25391294-25391316 GGATCTACCATTCTGAGATCTGG - Intronic
1065422980 10:25567734-25567756 TGTTTTACCATACTAAATTTTGG + Intronic
1073704243 10:105964318-105964340 GGCTCTTCCTTACTGAATTTGGG + Intergenic
1074469853 10:113716909-113716931 GGTTCTATCAGAATAAAATTTGG - Intronic
1077573912 11:3364020-3364042 ATTTTTATCATACTGAAATTTGG - Intronic
1078687465 11:13546692-13546714 GGATCTACCATTCTGGAATCTGG - Intergenic
1084142016 11:67238862-67238884 GGTTCTCCCATGCTGATGTTTGG + Intronic
1086007699 11:82058879-82058901 GCTTCTACCATGCTGTAATTAGG + Intergenic
1088497116 11:110442295-110442317 GGATCTACCATTCTGAGGTTTGG - Intronic
1088571595 11:111228569-111228591 GGTTCCATCATAATGAATTTTGG + Intergenic
1088608555 11:111555124-111555146 GGTCCTACCATGTTCAAATTGGG - Intronic
1092642998 12:10537530-10537552 GGATCTACCATTCTGAGGTTTGG + Intergenic
1094205361 12:27833920-27833942 GATACAACGATACTGAAATTAGG + Intergenic
1095728639 12:45480008-45480030 GTGTCTACCATACTTATATTGGG - Intergenic
1095935967 12:47681591-47681613 GGTTCAAAGATACTGAACTTAGG - Intronic
1097501507 12:60409768-60409790 GGATCTACCATTCTGAGATCTGG + Intergenic
1099663454 12:85596388-85596410 GGTTCTACCATTCTGGGGTTTGG + Intergenic
1101137188 12:101756353-101756375 AGTTTTACCTCACTGAAATTAGG - Intronic
1104588001 12:130062891-130062913 GGATCTACCATTCTGGAATCTGG - Intergenic
1108331137 13:49385676-49385698 GATACAACAATACTGAAATTAGG - Intronic
1109286050 13:60409362-60409384 GGCTCTACCATTCTGAAGTCTGG - Intronic
1109411902 13:61981404-61981426 GGTTCTACGATAGTGAATTGGGG - Intergenic
1109502449 13:63255569-63255591 GGATCTACCATTCTGGAATCTGG + Intergenic
1109853704 13:68101947-68101969 GGATCTACCATTCTGAGATTTGG + Intergenic
1111825926 13:93267648-93267670 AGTCCTACAATTCTGAAATTAGG - Intronic
1111883935 13:93995014-93995036 TGTTCTAACAAACTGAAATCAGG - Intronic
1112119621 13:96395691-96395713 GATTCAACCCTACTGAAACTGGG - Intronic
1113025997 13:105941774-105941796 GGCTCGATCATACTGAAGTTTGG + Intergenic
1116307486 14:43276828-43276850 TTATCTACAATACTGAAATTTGG + Intergenic
1119216309 14:72871810-72871832 GGATCTACCATTCTGGAATCTGG + Intronic
1120570998 14:86116463-86116485 GGATCTACCATCCTGGAGTTTGG - Intergenic
1120624419 14:86807087-86807109 ATTTCTAACATACAGAAATTAGG + Intergenic
1125854975 15:42939862-42939884 GTTTCTATCAGACTGAGATTGGG - Intergenic
1125875515 15:43140705-43140727 GTTTCTATCAGACTGAGATTGGG - Intronic
1126919747 15:53507920-53507942 GGTTCTTTCAATCTGAAATTTGG + Intergenic
1126942407 15:53781016-53781038 GGATCTACCATTCTGAGATCTGG + Intergenic
1127151096 15:56076179-56076201 GGTTATACCTTACGGAAGTTAGG - Intergenic
1127281059 15:57493474-57493496 GGTTCTGCCATATTGTACTTGGG - Intronic
1129119410 15:73386668-73386690 CATTCTATTATACTGAAATTGGG - Intergenic
1129289804 15:74556217-74556239 GACACAACCATACTGAAATTAGG - Intronic
1131410248 15:92201339-92201361 GGTTCTACCATTCTGGAGTCTGG - Intergenic
1131453542 15:92565661-92565683 GGTTCTACCATTCTGGAGTCTGG + Intergenic
1131726787 15:95235099-95235121 GGATCTACCATTCTGAGGTTTGG + Intergenic
1139228212 16:65254000-65254022 GGTTCTTCCATCGGGAAATTGGG - Intergenic
1140664762 16:77217312-77217334 GGTAGTAGGATACTGAAATTGGG - Intergenic
1143305377 17:5942231-5942253 GTTTCTACCAGACTGGAAATAGG - Intronic
1149101266 17:52909491-52909513 GGATCTACCATTCTGAAGTCTGG - Intergenic
1149791014 17:59477301-59477323 GGTTATACCATGCCTAAATTTGG - Intergenic
1149816606 17:59731140-59731162 GGATCTTCCAGATTGAAATTTGG - Intronic
1151157476 17:72135956-72135978 GATTCTACCATAGTGCAAGTAGG + Intergenic
1155346342 18:24861138-24861160 GCTTCTAGCACAGTGAAATTTGG + Intergenic
1155376980 18:25169713-25169735 GCTTCTAGGATACTGAAATGAGG + Intronic
1159718757 18:71858952-71858974 GGATCTACCATTCTGGAATCTGG + Intergenic
1160082073 18:75737239-75737261 GGATCTACCATTCTGAGATCTGG - Intergenic
1162124584 19:8492565-8492587 GGTTCTACTGTAATGAGATTTGG + Intronic
1164214156 19:23129253-23129275 GGATCTACCATTCTGGAATCTGG - Intronic
1166370920 19:42300375-42300397 GGTTCTTCCATAATGGCATTTGG - Intronic
929869525 2:45746566-45746588 GTTTCTACCTCACTGAAATGTGG + Intronic
929986689 2:46740911-46740933 GGTTCTGACATACTCAAATGTGG - Intronic
930227794 2:48812145-48812167 GGATCTACCATTCTGAGATCTGG + Intergenic
930299241 2:49594267-49594289 GGATCTACCATTCTGGAATCTGG - Intergenic
930862442 2:56089013-56089035 GGTTTTAACATGTTGAAATTGGG - Intergenic
933167410 2:79091824-79091846 GGTGGTTCTATACTGAAATTAGG - Intergenic
934536577 2:95139309-95139331 GGCTCTACCATTCTGGAATCTGG - Intronic
935329918 2:101969417-101969439 GGTTCTACCATTCTTGGATTTGG + Intergenic
937676905 2:124601177-124601199 GGTTGTACCATATTGAAAATGGG + Intronic
939635293 2:144575103-144575125 GCTCCTACCATTCTGAGATTGGG - Intergenic
940049366 2:149446038-149446060 GATACAACAATACTGAAATTAGG - Intronic
941734670 2:168960231-168960253 AGTTCTCACATACTGAACTTTGG - Intronic
943148384 2:184075934-184075956 GGTTCTACAATATTGAAGTAAGG + Intergenic
943203848 2:184864687-184864709 GTTTCTACAATACTGAAAAGTGG - Intronic
943664316 2:190592719-190592741 GGTTGCAGTATACTGAAATTTGG - Intergenic
944105128 2:196071431-196071453 CCCTCTACCATGCTGAAATTAGG - Intergenic
944618559 2:201487454-201487476 GGTTCTAACAAGATGAAATTTGG + Intronic
945206376 2:207337073-207337095 TTTTTAACCATACTGAAATTAGG + Intergenic
947580923 2:231317544-231317566 GGTTATACACTACTCAAATTTGG - Intronic
948878958 2:240846100-240846122 GGATCTACCATTCTGGAGTTTGG - Intergenic
1169535177 20:6531231-6531253 GGCACAACAATACTGAAATTAGG - Intergenic
1170197122 20:13700776-13700798 GGTTCTACATTACCCAAATTTGG - Intergenic
1170255861 20:14342279-14342301 GGTTTTACCATGCTGAAACTTGG + Intronic
1170710553 20:18786873-18786895 GGATCTACCATTCTGGAATCTGG + Intergenic
1172397242 20:34617237-34617259 GGATCTACCATTCTGGAATCTGG - Intronic
1172539796 20:35702421-35702443 GTTGCTACCAGAGTGAAATTTGG - Intergenic
1177258190 21:18692966-18692988 GGATCTACCATTCTGGGATTTGG + Intergenic
1178811112 21:35882259-35882281 GCTTCTTCCATAGTGAAATGGGG + Intronic
951126985 3:18995997-18996019 GGATCTACCATTCTGGAATCTGG + Intergenic
951755572 3:26087547-26087569 GGATCTACCATTCTGGAGTTTGG + Intergenic
952515640 3:34102305-34102327 GATGCAACAATACTGAAATTAGG - Intergenic
952585609 3:34888337-34888359 CATTCTACCATCCAGAAATTGGG + Intergenic
955833203 3:63026459-63026481 GGATCTACCATTCTGAGATGTGG + Intergenic
956238611 3:67104198-67104220 GGCTCTACCATTCTGGGATTTGG - Intergenic
959263461 3:104109584-104109606 GGATCTACTGTACTGAAATTGGG + Intergenic
959267919 3:104167617-104167639 GGATCTACCATTCTGAAGTCTGG + Intergenic
960632366 3:119744919-119744941 GGTTCTTCCTTAGTGATATTAGG - Intronic
960810769 3:121625190-121625212 GCTTGTACCATACTGAAGTGAGG + Intronic
963218963 3:142784858-142784880 GATTCTGCCAAACTGAGATTTGG - Exonic
964992937 3:162836598-162836620 ACTTCTACTATACTAAAATTTGG + Intergenic
966302729 3:178497015-178497037 GGATCTACCATTCTGGAATCTGG - Intronic
969276013 4:6136311-6136333 GGTTCAAGCAGACTGAAATATGG - Intronic
970061555 4:12039615-12039637 GGTTCTACCATTCTGGAGTCTGG - Intergenic
970896893 4:21114150-21114172 GGTTCTTACATACAGAAATAAGG + Intronic
971659750 4:29398164-29398186 GGGTCTACCATATTTGAATTGGG - Intergenic
972948038 4:44282443-44282465 GGTACAACAATACTGAAATTAGG + Intronic
973323663 4:48835408-48835430 GTTTTTACCAAATTGAAATTTGG - Intronic
973972671 4:56229192-56229214 GGTTCCAACATAATGAATTTTGG - Intronic
974101527 4:57422600-57422622 GGATCTACCATTCTGAAGTCTGG - Intergenic
974410146 4:61530352-61530374 GGTCTTGCCATACAGAAATTGGG + Intronic
974430561 4:61791562-61791584 GGATCTACCATTCTGAGATCTGG + Intronic
974775075 4:66469130-66469152 GGTTAAACTATACTAAAATTCGG - Intergenic
977050166 4:92119514-92119536 GGATCTACCATTCTGGAATCTGG - Intergenic
978210750 4:106132601-106132623 GGATCTACCATTCTCAGATTTGG - Intronic
979502630 4:121457512-121457534 GGTTCTACCAGAGTGACTTTGGG + Intergenic
982424943 4:155247385-155247407 GGATCTACCATTCTGGGATTTGG + Intergenic
983236668 4:165187910-165187932 GGTTCTACTAATCTGAAATCTGG + Intronic
983351520 4:166596750-166596772 GGTTCTATCATTCTCAAATCTGG - Intergenic
987655113 5:20796870-20796892 GGATCTACCATTCTGGAATCTGG + Intergenic
988129073 5:27079707-27079729 GGATCTACCATTCTGAACATAGG + Intronic
988643080 5:33063111-33063133 TGGTCTGCCATACTGAATTTTGG - Intergenic
988768449 5:34407032-34407054 GGATCTACCATTCTGGAATCTGG - Intergenic
988927789 5:36006761-36006783 GGATCTACCATTCTGGAATCTGG + Intergenic
990083428 5:51945068-51945090 GGATCTACCATTCTGAGATCTGG - Intergenic
990452735 5:55951068-55951090 GTATTTAACATACTGAAATTAGG - Intronic
992730558 5:79663496-79663518 GATGCAACAATACTGAAATTAGG - Intronic
994201083 5:96976981-96977003 GGTTCTAACATACTGCTTTTGGG - Intronic
994440765 5:99800377-99800399 GGATCTACCATTCTGAGATCTGG + Intergenic
995117760 5:108500815-108500837 GGATCTACCATTCTGGAATCTGG - Intergenic
997022006 5:130013282-130013304 GGATCTACCATTCTGGAGTTTGG + Intronic
999876884 5:155817333-155817355 TGTTCTGCCATTCTGATATTAGG + Intergenic
1000594490 5:163198644-163198666 GGTTCCACCATGTTAAAATTTGG + Intergenic
1000690412 5:164311794-164311816 GGTTTTACGATCCTGATATTTGG - Intergenic
1004720058 6:18261121-18261143 GGCTCTACCATGCTGGAGTTTGG - Intronic
1005246251 6:23889044-23889066 GGTTCTCCCTTACTGCAATAAGG - Intergenic
1007412171 6:41671309-41671331 AGTTCTACCAGCATGAAATTTGG - Intergenic
1008257999 6:49328096-49328118 TGTTCTATTATACTGCAATTGGG - Intergenic
1010879835 6:81153779-81153801 GGATCTACCATTCTGAAATCTGG + Intergenic
1015020534 6:128468330-128468352 GATGCTGCCAGACTGAAATTTGG - Intronic
1016135659 6:140538793-140538815 GGTTCTATAATATTGGAATTAGG + Intergenic
1016450217 6:144174830-144174852 GGTACTACAATACTAACATTAGG + Intronic
1016697353 6:147012910-147012932 GGTTTTCCCATAATTAAATTGGG - Intergenic
1021738824 7:23664776-23664798 GGTTCTACAATAGTGAACTGGGG + Intergenic
1023507639 7:40917338-40917360 GTTTCTACCATACATAAGTTAGG + Intergenic
1023690331 7:42779520-42779542 GGTTCTACCATTCTGGGGTTTGG - Intergenic
1024383167 7:48722703-48722725 GGCTCTACCACTCTGAAATCTGG + Intergenic
1024487212 7:49932227-49932249 GGTTCTACCATTCTGGGGTTGGG - Intronic
1027296227 7:76774400-76774422 GGTGCAACAATATTGAAATTAGG - Intergenic
1032374897 7:131403657-131403679 GATGCAACAATACTGAAATTAGG - Intronic
1032880526 7:136085045-136085067 GCTTCTAATATACTGAATTTTGG + Intergenic
1036106440 8:5845916-5845938 GGATCTACCATTCTGGGATTTGG + Intergenic
1038611137 8:29061193-29061215 GATTCTAACATAATGAAATGTGG - Intronic
1041901782 8:62990575-62990597 GGTGCTACAACACTGAAAATGGG - Exonic
1043644382 8:82499000-82499022 GGATCTACCATTCTGAAATCTGG - Intergenic
1044263050 8:90150278-90150300 GCTTCAACCTTAGTGAAATTCGG - Intergenic
1045597533 8:103673251-103673273 GGATCTACCATTCTGGATTTTGG + Intronic
1050101274 9:2122726-2122748 GGTTCTACCATACTGAAATTGGG - Intronic
1051753585 9:20370435-20370457 GATACAACAATACTGAAATTAGG + Intronic
1053047580 9:34932648-34932670 AGTAACACCATACTGAAATTTGG - Intergenic
1053655415 9:40214284-40214306 CGTTCTAACATTCTGTAATTGGG + Intergenic
1053905794 9:42843522-42843544 TGTTCTAACATTCTGTAATTGGG + Intergenic
1054367534 9:64360512-64360534 CGTTCTAACATTCTGTAATTGGG + Intergenic
1054529186 9:66162017-66162039 TGTTCTAACATTCTGTAATTGGG - Intergenic
1054675156 9:67850251-67850273 TGTTCTAACATTCTGTAATTGGG + Intergenic
1056653609 9:88490550-88490572 GCTTCACCCAGACTGAAATTAGG + Intergenic
1059082549 9:111265806-111265828 GGATCTACCATTCTGAGATCTGG + Intergenic
1059187096 9:112284183-112284205 GGATCTACCATTCTGAGATCTGG - Intronic
1186249923 X:7654835-7654857 GGTTCTGTCATGCTGAACTTTGG + Intergenic
1188016346 X:25111899-25111921 GGCTCTACCATTCTGGAATCTGG + Intergenic
1188461522 X:30432572-30432594 GGTGCTACTATATTGAAATTGGG - Intergenic
1188849097 X:35110305-35110327 GATTCTACCATTCTGGAATCTGG + Intergenic
1191694833 X:63978891-63978913 GGATCTACCATTCTGAGATCTGG + Intergenic
1193218094 X:78888308-78888330 GATGCAACAATACTGAAATTAGG + Intergenic
1193271865 X:79537923-79537945 GGATCTACTATTCTGGAATTTGG - Intergenic
1194841684 X:98751982-98752004 GGATCTACCATTCTGGAATCTGG + Intergenic
1195713330 X:107793326-107793348 GTTTCTATCATGCTAAAATTTGG + Intronic
1196698258 X:118637426-118637448 GGTTCTTCCACACTAAAAATTGG - Intronic
1196903487 X:120409729-120409751 GGATCTACCATTCTGGAATCTGG + Intergenic
1197023433 X:121717908-121717930 GGATCTACCATTCTGCAGTTTGG + Intergenic
1197719208 X:129733505-129733527 GGATCTACCATTCTGAGGTTTGG - Intergenic
1198947011 X:142026815-142026837 GGATCTACCATACTGGAGTGTGG + Intergenic
1199170904 X:144733449-144733471 GGATCTACCATTCTGAACTCTGG + Intergenic
1199993581 X:153004544-153004566 GGATCTACCATTCTGGCATTTGG + Intergenic
1200381617 X:155843122-155843144 GGATCTACCATTCTGAGATCTGG - Intergenic
1201906331 Y:19089293-19089315 GGTTCTAGCATCCTCAAGTTAGG - Intergenic
1202132017 Y:21621213-21621235 GGTTCCCCAATACTGAAATGTGG - Intergenic