ID: 1050101275

View in Genome Browser
Species Human (GRCh38)
Location 9:2122727-2122749
Sequence TGGTTCTACCATACTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050101275_1050101280 14 Left 1050101275 9:2122727-2122749 CCAATTTCAGTATGGTAGAACCA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG No data
1050101275_1050101278 -6 Left 1050101275 9:2122727-2122749 CCAATTTCAGTATGGTAGAACCA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1050101278 9:2122744-2122766 GAACCAAAGGAAGAAGGAAAAGG No data
1050101275_1050101281 29 Left 1050101275 9:2122727-2122749 CCAATTTCAGTATGGTAGAACCA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1050101281 9:2122779-2122801 ATTGATGGTCCATTTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050101275 Original CRISPR TGGTTCTACCATACTGAAAT TGG (reversed) Intronic
906842005 1:49148942-49148964 TGGTGCCAACATACTGAATTTGG + Intronic
909167376 1:72246671-72246693 TGGCTCTACAATTCTGCAATTGG + Intronic
909970300 1:81976578-81976600 TGTTTCTAACATACTTAAAATGG - Intronic
912308631 1:108596637-108596659 TGCATCTACCATACAGGAATAGG - Intronic
914005672 1:143730335-143730357 TTTTTCTACAATACTGAAGTTGG - Intergenic
914098138 1:144561581-144561603 TTTTTCTACAATACTGAATTTGG - Intergenic
914300843 1:146376035-146376057 TTTTTCTACAATACTGAATTTGG + Intergenic
917515356 1:175702545-175702567 TGGTTATCCCATGCTGAAATGGG + Intronic
918875252 1:190032873-190032895 TGGTACTAGCATAAAGAAATAGG - Intergenic
923964968 1:239127430-239127452 AGGTTCCTCTATACTGAAATGGG - Intergenic
1065521789 10:26580281-26580303 TTCCTCTACCATAATGAAATCGG - Intergenic
1071838434 10:89443478-89443500 TGGTTCTTCCATATAGAGATAGG - Intronic
1073704242 10:105964317-105964339 TGGCTCTTCCTTACTGAATTTGG + Intergenic
1074122322 10:110501804-110501826 CGGTTCTTCCCCACTGAAATGGG + Intronic
1075746278 10:124730181-124730203 TGTTCCTACCATGCTGGAATGGG - Intronic
1076531040 10:131144700-131144722 TAGGTCTACCATAATAAAATGGG + Intronic
1086114565 11:83234212-83234234 TGTTTCTACTGTACTAAAATTGG + Intronic
1086212951 11:84342793-84342815 TGGGTCTAAAATAGTGAAATAGG + Intronic
1087565776 11:99855365-99855387 TGTTTCTATCATACTGAACTTGG - Intronic
1088701273 11:112414463-112414485 TGGTATAACTATACTGAAATAGG + Intergenic
1089549587 11:119262398-119262420 TAGTACTACCATACTGATGTTGG + Intronic
1092572661 12:9741994-9742016 TGGTCTAACCACACTGAAATGGG + Intergenic
1095358841 12:41310841-41310863 TGGTTCTAACATACATAAAAGGG + Intronic
1098377107 12:69828207-69828229 TAGCTCTACCACACTGAAAGGGG - Intronic
1105267354 13:18833508-18833530 TTGTTCTACCATTTTGAAAAAGG - Intergenic
1106596178 13:31140741-31140763 TGGTTTTTCCATACTGAGGTGGG - Intronic
1108850906 13:54728053-54728075 TGGATCTACCATTCTGGATTTGG - Intergenic
1109411903 13:61981405-61981427 AGGTTCTACGATAGTGAATTGGG - Intergenic
1110608717 13:77464606-77464628 TAGTTCTGCCATACTGAGAGTGG - Intergenic
1110839902 13:80129963-80129985 TGGTTTGACCATGCAGAAATCGG + Intergenic
1110851439 13:80249873-80249895 TGATTCTTCCAAACTGAAACTGG + Intergenic
1120910279 14:89660250-89660272 TGGTTCTTCCCCACTGATATAGG + Intergenic
1127211115 15:56775855-56775877 TGTTTAAACCATACTGAAACAGG - Intronic
1127281060 15:57493475-57493497 TGGTTCTGCCATATTGTACTTGG - Intronic
1128961952 15:72015521-72015543 TGGTTCCACCATGCTGCAAAGGG - Intronic
1134115790 16:11547368-11547390 TGTTTTTACGATCCTGAAATAGG + Intergenic
1139228213 16:65254001-65254023 TGGTTCTTCCATCGGGAAATTGG - Intergenic
1149162928 17:53716482-53716504 TTGTTCTACCATAGAGACATGGG - Intergenic
1149244976 17:54695226-54695248 TGGTTTTACTATAATGGAATTGG + Intergenic
1151249837 17:72825550-72825572 TGGATCTACCATTCTGGGATTGG - Intronic
1153718820 18:7880587-7880609 TGGTTTCATCAGACTGAAATGGG + Intronic
1154408098 18:14115194-14115216 TGGTTGTACCATGCTGTACTGGG - Intronic
1154421057 18:14227927-14227949 TTGTTCTACCATTTTGAAAAAGG + Intergenic
1155647993 18:28103930-28103952 TGGTTCTACAATAGAAAAATGGG + Intronic
1155867710 18:30986790-30986812 TTGTTCTACCTTAATGAAGTGGG - Intergenic
1156900450 18:42295036-42295058 TGGTTCTGCCAAACTTAACTGGG - Intergenic
1162634963 19:11960833-11960855 TCTTTCTGCCATTCTGAAATTGG + Intronic
1165588160 19:36939905-36939927 TAATTCTACCATATTGAAACAGG + Intronic
1165989802 19:39803890-39803912 TGGTTCTCCTAGAGTGAAATTGG - Intergenic
927276130 2:21263948-21263970 TGGTGCTATCATACTAAAACAGG - Intergenic
927549950 2:23989603-23989625 TGGCCCTACCAGACTGAAAGTGG - Intronic
928061779 2:28121005-28121027 TGGTTCCTCCAAACGGAAATGGG - Intronic
929376116 2:41289000-41289022 TGGTTCTACCATTCTGAGGTTGG + Intergenic
932441245 2:71736953-71736975 TGGAGCTACCTCACTGAAATTGG + Intergenic
935296103 2:101650987-101651009 TGGTGTTCCCATACTGAAAACGG + Intergenic
937676904 2:124601176-124601198 AGGTTGTACCATATTGAAAATGG + Intronic
937854879 2:126665086-126665108 TGCTTCTGCAATAATGAAATAGG - Intronic
939635294 2:144575104-144575126 TGCTCCTACCATTCTGAGATTGG - Intergenic
941724180 2:168843069-168843091 TTATTCTACCAGACTGAAATGGG + Exonic
945272173 2:207952042-207952064 TGGATTTACCTTACTGAATTAGG - Intronic
1172069175 20:32243781-32243803 TGCATCTACAATACAGAAATAGG + Intergenic
1173113484 20:40218092-40218114 TGGTTCTGCCACATTTAAATGGG + Intergenic
1176852415 21:13932039-13932061 TTGTTCTACCATTTTGAAAAAGG - Intergenic
1178811111 21:35882258-35882280 AGCTTCTTCCATAGTGAAATGGG + Intronic
1179418803 21:41219612-41219634 TGGTTCAACCAGACTGACCTAGG + Intronic
1182999618 22:34844323-34844345 TGGATCTACCATCCTGAAGGAGG - Intergenic
952484369 3:33795229-33795251 TGGCTCCACCAAACTGCAATGGG - Intergenic
956070500 3:65444987-65445009 TGGTTCTAAAAGACTGAAAAAGG + Intronic
956553007 3:70482932-70482954 TGCTTCTACATGACTGAAATAGG - Intergenic
959112515 3:102138636-102138658 TTGTTCTAGCATGTTGAAATAGG + Intronic
959263460 3:104109583-104109605 TGGATCTACTGTACTGAAATTGG + Intergenic
959836060 3:110919426-110919448 TGGTTCCACCATTCAGAAAATGG - Intergenic
963136150 3:141906623-141906645 TGGTTTTCACATACTGAATTTGG - Intronic
963286895 3:143442087-143442109 TGGTTTGGCCTTACTGAAATAGG + Intronic
964703263 3:159592162-159592184 GGGTTCTACTGAACTGAAATGGG + Intronic
971662297 4:29435348-29435370 TGGCTCTATGACACTGAAATAGG + Intergenic
973124113 4:46562512-46562534 TGGTGCTACAAAAGTGAAATGGG - Intergenic
973845748 4:54911429-54911451 TTCTTCTACCATACTGAGAAGGG + Intergenic
974410145 4:61530351-61530373 TGGTCTTGCCATACAGAAATTGG + Intronic
975294626 4:72719192-72719214 TGATTCTAACATTCTGAGATTGG + Intergenic
977424348 4:96847585-96847607 TAGTTCTACCATGCTCAAAATGG + Intergenic
979134893 4:117098427-117098449 TGGATTTAACATACTGAAAGCGG - Intergenic
992354401 5:75966378-75966400 TTATGCTACCCTACTGAAATAGG + Intergenic
995922395 5:117329839-117329861 TGGATCTCCCATATTGATATAGG - Intergenic
996472303 5:123875117-123875139 TGGTTTTAGCATAATGAATTAGG + Intergenic
1002487274 5:179548060-179548082 TGGTTTTCCCAGACAGAAATAGG + Intergenic
1005003815 6:21268740-21268762 TGGTCCTAGCATACTGAGATAGG + Intergenic
1006555419 6:34861983-34862005 TGGTTCTACCTGAGTAAAATGGG - Intronic
1008271441 6:49494982-49495004 TGGCTCTACCATTCTGAGGTTGG - Intergenic
1011204068 6:84872489-84872511 TGCTTCTGCCAATCTGAAATGGG + Intergenic
1014598903 6:123384307-123384329 TGACTCCACTATACTGAAATAGG + Intronic
1016612677 6:146010165-146010187 TGGTTTTTCTATGCTGAAATGGG + Intergenic
1016697354 6:147012911-147012933 TGGTTTTCCCATAATTAAATTGG - Intergenic
1017055138 6:150429899-150429921 AGCTTCTACCACACTGAGATGGG - Intergenic
1017142897 6:151207772-151207794 TGGTTCTTCCTTTCTAAAATGGG - Intergenic
1018877673 6:167839767-167839789 TTTATCTCCCATACTGAAATGGG - Intronic
1021738823 7:23664775-23664797 AGGTTCTACAATAGTGAACTGGG + Intergenic
1023727130 7:43154803-43154825 TGTTTCTTCCATAGTGAAATAGG + Intronic
1024487213 7:49932228-49932250 TGGTTCTACCATTCTGGGGTTGG - Intronic
1025616942 7:63128082-63128104 TTGTTCTACCATAAAGACATAGG + Intergenic
1025747624 7:64258037-64258059 TCTTCCTACCAAACTGAAATAGG - Intronic
1026137748 7:67678317-67678339 TGGGCTTACCAGACTGAAATGGG + Intergenic
1028491412 7:91416005-91416027 GGGTTCTATCATTCTGAAATGGG + Intergenic
1034830115 7:154301743-154301765 TGTTCTTACCATAATGAAATAGG - Intronic
1046530999 8:115444778-115444800 TGACTCCACCATCCTGAAATTGG + Intronic
1049316059 8:141968724-141968746 TGGTTCTAACATCCAAAAATCGG - Intergenic
1050101275 9:2122727-2122749 TGGTTCTACCATACTGAAATTGG - Intronic
1050399665 9:5239060-5239082 TTGTTCTACCATCTTGAAACTGG - Intergenic
1050719182 9:8565549-8565571 TGTTGCTACCATACAGAAATAGG + Intronic
1051406504 9:16743394-16743416 TGGTTCTACCCCTCTGAAAGAGG + Intronic
1058547134 9:106072647-106072669 AGGTTATACCATACTGATAGAGG - Intergenic
1186814607 X:13224190-13224212 TGTTCCTACCAGATTGAAATAGG + Intergenic
1187322497 X:18252650-18252672 TGGTTCTTCCCTTCTGGAATTGG - Intronic
1188100167 X:26072993-26073015 CTGTTCTACCATACTGCAAGAGG - Intergenic
1188461523 X:30432573-30432595 GGGTGCTACTATATTGAAATTGG - Intergenic
1192537153 X:71938030-71938052 TGGTTCCACCCAACTGTAATGGG + Intergenic
1193387275 X:80886276-80886298 TGGATCTACCATTCTGGAGTCGG + Intergenic
1194211211 X:91071975-91071997 AGGTTCAATCATACTGAAACAGG + Intergenic
1194955559 X:100175319-100175341 TCTTTTTACCATGCTGAAATAGG - Intergenic
1195938297 X:110145685-110145707 CATTTCTACCATACTGAAAGTGG + Intronic
1196857178 X:119995325-119995347 TGGTTTTGCCATATTGCAATTGG - Intergenic
1202016959 Y:20419739-20419761 TGGTTCTAGCAGACTTATATTGG + Intergenic