ID: 1050101279

View in Genome Browser
Species Human (GRCh38)
Location 9:2122747-2122769
Sequence TTACCTTTTCCTTCTTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1126
Summary {0: 1, 1: 0, 2: 10, 3: 126, 4: 989}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050101279_1050101280 -6 Left 1050101279 9:2122747-2122769 CCAAAGGAAGAAGGAAAAGGTAA 0: 1
1: 0
2: 10
3: 126
4: 989
Right 1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG No data
1050101279_1050101281 9 Left 1050101279 9:2122747-2122769 CCAAAGGAAGAAGGAAAAGGTAA 0: 1
1: 0
2: 10
3: 126
4: 989
Right 1050101281 9:2122779-2122801 ATTGATGGTCCATTTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050101279 Original CRISPR TTACCTTTTCCTTCTTCCTT TGG (reversed) Intronic
900317420 1:2065297-2065319 TTACTTTTTCCTTCCTAATTTGG + Intronic
900845278 1:5094144-5094166 TGCCCTTTTTCATCTTCCTTTGG - Intergenic
901767211 1:11510645-11510667 TACCATTTTCCTTCTTCCTGAGG + Intronic
903437411 1:23361437-23361459 GTATCTTTTCCATCTTCCTGAGG - Exonic
903826404 1:26148764-26148786 TTGCCCCTTCCTTCTTCCTTGGG + Intergenic
903961451 1:27060320-27060342 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
904614772 1:31743753-31743775 TGACCTTCCCCTCCTTCCTTTGG - Intronic
904731845 1:32598814-32598836 TTATCTTTGCTTGCTTCCTTTGG - Intronic
905497987 1:38410233-38410255 TTTCATTTTTCTGCTTCCTTTGG - Intergenic
905979710 1:42212617-42212639 TTAACTTTTTCTTCTCCCTTAGG - Intronic
906180910 1:43817894-43817916 TTTCTTTTTTCTTCTTCTTTTGG + Intronic
906571233 1:46843264-46843286 TTATCCTTCCATTCTTCCTTTGG + Intergenic
906600037 1:47117978-47118000 TTATCCTTTTGTTCTTCCTTTGG - Exonic
907119398 1:51995081-51995103 TTTCCTTCCCATTCTTCCTTGGG - Intergenic
907832245 1:58076068-58076090 TTTCCTTTTCTTTCATCCCTTGG - Intronic
908212418 1:61914646-61914668 TTACCTTTTCTTTCTTTTCTTGG - Exonic
908923545 1:69225340-69225362 TTTCCTTTTCCTTTTTTTTTGGG + Intergenic
908956870 1:69642385-69642407 TTATCTTTTCCTTTTTTCTTGGG - Intronic
908986732 1:70032760-70032782 TTTCCTTTGACTTCTTCCTGAGG + Intronic
909168323 1:72257770-72257792 TTACCTGATCATTCTTCCCTTGG + Intronic
909217992 1:72916096-72916118 TTCCCTTTACCATCTTTCTTTGG + Intergenic
909361049 1:74759188-74759210 GGACCTATTACTTCTTCCTTAGG - Intronic
909672200 1:78202320-78202342 TTACCTTTTCCAGCTTTCTGGGG + Intergenic
910233943 1:85015206-85015228 TTATTTTTTTCTACTTCCTTTGG + Intronic
910253641 1:85224056-85224078 TTACCTTTTCTTTTTTAGTTAGG - Intergenic
910728125 1:90360119-90360141 TTTACTTTTCCTCCTGCCTTTGG + Intergenic
910811580 1:91242782-91242804 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
911653334 1:100414553-100414575 TTTCATTTTCTTTCTTCATTTGG + Intronic
911965092 1:104358451-104358473 TTACCATTTCCATCAACCTTAGG + Intergenic
912035915 1:105313239-105313261 TTTCTTTTTCTTTCTTTCTTTGG - Intergenic
912048812 1:105496418-105496440 TTAGCTTTTGCTAATTCCTTCGG + Intergenic
912597218 1:110891370-110891392 TTTCTTCTTCCTTATTCCTTAGG + Exonic
912612319 1:111060979-111061001 TTAGATTTGTCTTCTTCCTTGGG + Intergenic
912815679 1:112826228-112826250 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
913232509 1:116752879-116752901 TCATCTTTTCTTTCTTACTTTGG + Intergenic
913483462 1:119311889-119311911 CTACCTCTTCTTTCTGCCTTTGG - Intergenic
914356900 1:146894265-146894287 TTTCCTTTGCATTCTTCATTTGG + Intergenic
915716443 1:157949314-157949336 TCACATCTTCCTTCCTCCTTGGG - Intergenic
915785346 1:158605574-158605596 TTACCCTTTCCAAATTCCTTGGG - Intergenic
915957757 1:160237226-160237248 TTTCCTTTTTCTTCTTCAGTTGG - Exonic
916506377 1:165431563-165431585 TTGACTTTTCCTTCTTGCTTAGG + Intronic
916567955 1:165998164-165998186 AAACCTTGTCCATCTTCCTTTGG - Intergenic
916626780 1:166566851-166566873 TAACCTTTTGCTCATTCCTTAGG + Intergenic
916761007 1:167817920-167817942 TTATATTTTCTTTCTTACTTTGG + Intronic
916975571 1:170074285-170074307 TCACCTTTTCCCTCTCCTTTCGG + Intronic
917087931 1:171322345-171322367 TTATCTTTTCCTTCTTTCATTGG - Intronic
917091568 1:171358674-171358696 TTATCTTTGCCTGCTTTCTTAGG - Intergenic
917220013 1:172718586-172718608 ATGACTTTTCCTTCTTCCATGGG - Intergenic
917872477 1:179254370-179254392 TTGCCTTTTCCATCTTCTGTAGG - Intergenic
917927611 1:179802186-179802208 TTTCATTTACCTTCTTCCATAGG + Intronic
918208782 1:182332673-182332695 TTATCGTTTCCTTTTTCCTTGGG + Intergenic
918424437 1:184393827-184393849 TTACCTTTTTTTTTCTCCTTTGG + Intronic
918623962 1:186636921-186636943 TTAGCAATTCCTTTTTCCTTGGG - Intergenic
918647896 1:186923063-186923085 TTAGTTTTTACTTCTTTCTTTGG + Intronic
918888975 1:190238997-190239019 TTCCCTTCACCTTCTGCCTTCGG - Intronic
919081332 1:192869860-192869882 TTAACTTTTTTTTCATCCTTGGG + Intergenic
919283491 1:195522027-195522049 TTACCTTTACTTTATTCCTGGGG + Intergenic
919348696 1:196419817-196419839 ATGCCTTTTCCTTTTTCCTTTGG + Intronic
919407897 1:197207823-197207845 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
919496980 1:198285088-198285110 TTATTTTTTCTTTTTTCCTTAGG + Intronic
919520430 1:198581610-198581632 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
919610168 1:199735643-199735665 TACCCTTTTACTTCTTCATTTGG - Intergenic
920049439 1:203154490-203154512 TCACTTTGTCCTTCTGCCTTGGG - Intronic
920176689 1:204106178-204106200 TTTCCTTTTCTTTTTACCTTGGG - Intronic
920254514 1:204645325-204645347 TTCCCTGTTCCTGTTTCCTTGGG - Intronic
920334661 1:205236920-205236942 TGACCTTTTCCCACTTGCTTTGG + Intronic
920504023 1:206504093-206504115 TTCCGTTTTCCTTCTTACTAGGG + Intergenic
920726942 1:208445316-208445338 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
920973859 1:210767146-210767168 TTACTTTCTCATTCTTTCTTTGG - Intronic
921061387 1:211587966-211587988 TTGCCTTTTCCAACTTCCGTTGG - Intergenic
921097598 1:211900652-211900674 ATACTTTTTCCTTATTGCTTTGG + Intergenic
921108099 1:212003515-212003537 GTTACTTTTCCTTCTGCCTTCGG - Intronic
921196017 1:212759174-212759196 TTACCTATTTTTTTTTCCTTTGG - Intronic
921266787 1:213427409-213427431 TGATCTTTTCCTTTTTGCTTTGG + Intergenic
921278110 1:213539128-213539150 TTTCTTTTTGCTCCTTCCTTGGG + Intergenic
921366106 1:214375942-214375964 TTAACTTTTCCTTCTCTCTGTGG - Intronic
921385046 1:214560397-214560419 TGAGCTTATCCTTGTTCCTTTGG + Intergenic
921387643 1:214586939-214586961 CTTCCCTTTCCTTCTACCTTAGG - Intergenic
921532755 1:216306116-216306138 TTAGATTTCTCTTCTTCCTTGGG + Intronic
921601273 1:217109406-217109428 TTGCCTTTTACTGCTTGCTTGGG - Intronic
921828076 1:219696137-219696159 TTCCCTTTTCTTTCTTTTTTTGG - Intronic
921890001 1:220344290-220344312 CTGCCTTTTCCTTTTTCCATAGG + Intergenic
922160526 1:223076487-223076509 TTCTCTTTTCCTCCTTCCTTTGG + Intergenic
922434851 1:225594019-225594041 TTCCCTTTTCAATCTGCCTTAGG + Intronic
922540198 1:226413228-226413250 TTACATTATTCTTCTTCCTCAGG + Intergenic
922793775 1:228326986-228327008 GTTCCTTTTCCTTTTTACTTTGG - Intronic
923378677 1:233392652-233392674 TTTCCTTTTCCTTCTCCTTCAGG + Intergenic
923699139 1:236283041-236283063 TTACCTTTTCCAGCTTCCAGAGG + Intergenic
923935171 1:238751932-238751954 CTACATTTTTCTTTTTCCTTTGG - Intergenic
924275179 1:242378928-242378950 TCAGCTTTTCCTTCCTACTTAGG + Intronic
924734827 1:246746471-246746493 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1063129347 10:3164267-3164289 TTACCTTTTCATTCTCAATTTGG - Intronic
1063221515 10:3972933-3972955 TTTCCCTTTCATTCTACCTTGGG - Intergenic
1063404866 10:5784043-5784065 TTAGATTCTTCTTCTTCCTTGGG + Intronic
1063770368 10:9190949-9190971 TGACCTTTACTCTCTTCCTTTGG - Intergenic
1063794360 10:9494476-9494498 TCACCTTTTCCTGCCTTCTTAGG + Intergenic
1064233629 10:13552897-13552919 TTACTCTTTCCTTCTTGCTTTGG - Intergenic
1064477962 10:15711772-15711794 TTACCCTTTCTTTCTTTTTTTGG - Intronic
1064523123 10:16224564-16224586 TTAACTTTTCTGTCTACCTTTGG + Intergenic
1064557078 10:16558327-16558349 TTAGATTTTTCTTCTTCCTAGGG + Intergenic
1064862817 10:19846120-19846142 CAACCTTTCACTTCTTCCTTTGG + Intronic
1065329116 10:24575095-24575117 TTAGCATTTCTTCCTTCCTTGGG - Intergenic
1065378334 10:25064745-25064767 TTACCCTTCCCTCCTTCTTTGGG - Intergenic
1065628674 10:27655540-27655562 TTATATTTTCCTTCTTACATTGG - Intergenic
1065704337 10:28458109-28458131 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1065782721 10:29185606-29185628 TTTCCTTTTCTTTCTCTCTTTGG - Intergenic
1065982965 10:30920471-30920493 TTAATTTTTCCTTCTTTCATAGG + Intronic
1066054618 10:31669078-31669100 TTTCCTTCTCCTTCTTTCTTTGG + Intergenic
1066295118 10:34047366-34047388 TTAGCTTTTCCATCTTTCATTGG + Intergenic
1066447383 10:35496026-35496048 TTTCCCTTTCCTTTTTCCTGTGG - Intronic
1066519160 10:36196530-36196552 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1067420318 10:46139763-46139785 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1067425703 10:46209754-46209776 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1067505662 10:46846248-46846270 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1067516780 10:46954758-46954780 TTCCTTTTTCCTTCTTGCTTTGG + Intronic
1067543584 10:47175733-47175755 TTACCTTTTATTACTCCCTTCGG + Intergenic
1067645471 10:48097068-48097090 TTCCTTTTTCCTTCTTGCTTTGG - Intergenic
1067723137 10:48745023-48745045 TTATCATTTCCTTCTACCTTTGG + Intronic
1067734771 10:48841629-48841651 TCACATTTTCCTGCTTTCTTAGG + Intronic
1068018045 10:51542905-51542927 TAACGTTTTGATTCTTCCTTTGG + Intronic
1068080972 10:52316273-52316295 TCACTATTTCCTGCTTCCTTAGG + Exonic
1068151015 10:53131604-53131626 TGACCTTTTCCTCCTTCTTCAGG + Intergenic
1068480713 10:57585361-57585383 TTTCCTTCTCCTTCTCCCTGTGG - Intergenic
1068505799 10:57897878-57897900 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1069606903 10:69744450-69744472 ATGCCTTTTCCTCCTTCCCTGGG + Intergenic
1069648267 10:70020753-70020775 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1070050739 10:72887197-72887219 TTCTCTTTTTCTTCCTCCTTTGG + Exonic
1070732673 10:78842172-78842194 CCACCTTTTCCTGCCTCCTTAGG - Intergenic
1071146745 10:82583900-82583922 TTAGCTTTTCCATGTTCATTTGG - Intronic
1071240357 10:83698338-83698360 TTACCATTTCTTTCTTTCTATGG + Intergenic
1071588533 10:86848599-86848621 CTACCTTTTCTTCCTGCCTTTGG + Intronic
1072109555 10:92305710-92305732 TTACAACTTCCTTTTTCCTTGGG + Intronic
1072209909 10:93237037-93237059 TTCCCCTTTATTTCTTCCTTGGG + Intergenic
1072335255 10:94392194-94392216 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1072352117 10:94567179-94567201 TCACCTTTTCCTTCCTCACTGGG + Intronic
1072494315 10:95940408-95940430 TTACCATTTTCTTTTTCTTTAGG + Intergenic
1072769123 10:98122908-98122930 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1072871787 10:99127531-99127553 TTAGATTTCTCTTCTTCCTTAGG - Intronic
1073758111 10:106602923-106602945 CTGCCTTTCCTTTCTTCCTTAGG + Intronic
1074551154 10:114443728-114443750 TTTCCTTTTGCTGCTTCCCTTGG + Intronic
1074713642 10:116198659-116198681 TTTCCTTTTCTATCTTCCTCAGG + Intronic
1074771669 10:116738996-116739018 TGACCTTTGCTTACTTCCTTTGG + Intronic
1074986126 10:118661511-118661533 TTAGATTTCCCTTCTTCCTCAGG + Intergenic
1075139898 10:119823181-119823203 TTACCTTTTCCATCCTCTTCAGG - Exonic
1075231469 10:120683397-120683419 TTAGGTTTTTTTTCTTCCTTTGG + Intergenic
1075271142 10:121052409-121052431 TTATCTCTTCCTTCTTCCTTTGG - Intergenic
1075493924 10:122901623-122901645 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1076006927 10:126955445-126955467 TTACATTTTCATTTTGCCTTGGG + Intronic
1076045369 10:127289793-127289815 TTCCCTTTCTCTTCTTCTTTTGG + Intronic
1076516296 10:131046640-131046662 CTACCTTCTCCTTCTTCCCCAGG - Intergenic
1076576273 10:131471710-131471732 TTTCTTTTTCCTTCTTTCTTAGG + Intergenic
1077455491 11:2676165-2676187 TTGCCTTTGACTTCTTCCATAGG + Intronic
1077622106 11:3735187-3735209 TTACCTCTTCCTTCTTCTTAGGG + Exonic
1077743559 11:4875517-4875539 TTACCTTTTCCATCTTCTAAAGG + Intronic
1078522295 11:12073213-12073235 TCACCTTTTCCTGCTTCCAGAGG - Intergenic
1078562249 11:12383173-12383195 TGATCTTTTTCTTCTTCTTTTGG + Intronic
1078699117 11:13664029-13664051 TTTCTTTTTCTTTCTTTCTTAGG - Intergenic
1078938684 11:15976463-15976485 TTCCCTTTCCTTTCCTCCTTTGG + Intronic
1079044263 11:17085807-17085829 TTAGTTTTTACTTCTTTCTTTGG - Intronic
1079270968 11:18985736-18985758 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
1079440169 11:20505733-20505755 TGATCTTTTATTTCTTCCTTAGG + Intronic
1079744065 11:24102241-24102263 TTCCCTTTCCCTTCCTCCCTAGG - Intergenic
1079956233 11:26868794-26868816 TAATATTTTTCTTCTTCCTTAGG - Intergenic
1080585741 11:33681437-33681459 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
1080939457 11:36898938-36898960 TTACCTATTCCTGCTTCTATGGG - Intergenic
1081367597 11:42255143-42255165 TTACCTCTTCCTTTTTAATTTGG + Intergenic
1081530077 11:43952399-43952421 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1081712839 11:45228583-45228605 TTGCCTTTTCTTTTTTCATTTGG + Intronic
1081942542 11:46956001-46956023 TTACCATTTCTTTCTTTTTTTGG - Intronic
1082104073 11:48200924-48200946 TTAAATTTCTCTTCTTCCTTGGG - Intergenic
1082253101 11:50003290-50003312 TTAGATTTCTCTTCTTCCTTAGG - Intergenic
1082621033 11:55422499-55422521 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1082631304 11:55545182-55545204 TTGCCCTTTCTTGCTTCCTTTGG + Intergenic
1082769022 11:57191430-57191452 TTCCCTTTTGCCTCTTCCTGGGG - Exonic
1083518726 11:63286367-63286389 ATACCCTTTCTTTCTTTCTTTGG - Intronic
1083983160 11:66191138-66191160 TTGCCTTTTCCTGCTTCTTGAGG + Intronic
1084727110 11:70949128-70949150 TTTCTTTTCCCTTCTTCTTTTGG - Intronic
1085240183 11:75046738-75046760 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1085689110 11:78651275-78651297 TTACCTCTTCCTCCTTCCTGAGG + Intergenic
1085721627 11:78917363-78917385 TGACCCTTACCTTCTTCCTCAGG + Intronic
1085772555 11:79338309-79338331 TTTTCATTTCCTTCTCCCTTGGG + Intronic
1086151296 11:83613780-83613802 TTATCTTTTCTTTCTTTTTTTGG - Intronic
1086263833 11:84974082-84974104 TTTCCCTCTCCTACTTCCTTTGG - Intronic
1086297744 11:85389394-85389416 TTAGATTTCTCTTCTTCCTTGGG - Intronic
1086377357 11:86214885-86214907 TTCCCTGTTTCCTCTTCCTTGGG + Intergenic
1086438709 11:86806924-86806946 TAAAATATTCCTTCTTCCTTTGG - Intronic
1086616704 11:88830507-88830529 TTCCCTTTCCTTTCTGCCTTAGG - Intronic
1086783566 11:90936838-90936860 TTTCCTTTTCATGCTTTCTTTGG - Intergenic
1086790575 11:91033035-91033057 TTCCCTTTTCAATTTTCCTTGGG + Intergenic
1087267534 11:96077159-96077181 TTTCCTTTTATTTCTCCCTTGGG + Intronic
1087749435 11:101990548-101990570 TTAACTTTGCCTTCTATCTTTGG - Intronic
1087804461 11:102540394-102540416 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1087817425 11:102675110-102675132 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1088135126 11:106546870-106546892 CTACCTTGTCCTTCTTCTTTGGG - Intergenic
1088193713 11:107253714-107253736 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1088552564 11:111028029-111028051 TTTGCTTTTTCTTCTCCCTTAGG - Intergenic
1088800215 11:113298515-113298537 TTAGATTTCTCTTCTTCCTTAGG - Intergenic
1088951296 11:114572748-114572770 TTAAATTTCTCTTCTTCCTTGGG - Intronic
1088981109 11:114864812-114864834 TTACCTTCTCCGTTTTCCATAGG + Intergenic
1089030566 11:115323774-115323796 TTTCCTCCTCCCTCTTCCTTTGG - Intronic
1089147952 11:116344082-116344104 TTACCTTTTCCTGCTTCCAGAGG + Intergenic
1089830308 11:121321559-121321581 TTGACTTTTCCATATTCCTTAGG - Intergenic
1089950174 11:122518424-122518446 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1090524299 11:127514300-127514322 TTCCTTTCTACTTCTTCCTTTGG + Intergenic
1091514209 12:1161784-1161806 TTACCATATTCTTCTTCCTTAGG - Intronic
1091814064 12:3422773-3422795 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1093604372 12:21072652-21072674 TTAGATTTCTCTTCTTCCTTAGG + Intronic
1093608346 12:21122428-21122450 TTAGATTTTCCTTATTCCTCAGG - Intronic
1093948514 12:25136949-25136971 TTAGATTTCTCTTCTTCCTTGGG - Intronic
1094175167 12:27533873-27533895 TTACGTTGTGCTTCTTCCCTTGG - Intronic
1094745499 12:33340230-33340252 TCACCATTTCCTCCTTCCTTGGG + Intergenic
1095178583 12:39121650-39121672 TTAGATTTCCCTTCTTCCTTGGG + Intergenic
1095189384 12:39238853-39238875 TTACCTTGTCCTTCCTGCCTGGG - Intergenic
1095551355 12:43444714-43444736 TTTCCTTTTCCTTATTTATTAGG + Intronic
1095701486 12:45195249-45195271 TTACCCCTTCCTTCTTAATTTGG - Intergenic
1095897364 12:47293290-47293312 TTAGCTTTTACTTCTTTCTTTGG - Intergenic
1096472628 12:51888926-51888948 TAACCATTCCCTTCCTCCTTAGG - Intronic
1096843896 12:54395000-54395022 GTTCCTTTCCCTTCTCCCTTGGG + Intergenic
1097175214 12:57138617-57138639 TTAACTTATCCCTCTTCCTTTGG + Intronic
1097299315 12:58001583-58001605 TTAGATTTTCCCTCTTCCTAGGG + Intergenic
1097543359 12:60968380-60968402 TTAATTTTTCCTTTTGCCTTAGG + Intergenic
1097604559 12:61736611-61736633 TTACATTTTCCATTTTGCTTGGG + Intronic
1098220037 12:68259660-68259682 CCACCTTTCCCTTCTTCCTGGGG + Intergenic
1098747927 12:74264356-74264378 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1098980474 12:76950674-76950696 TTTCTTTTACCTTCTTCCTAAGG + Intergenic
1099230802 12:80022418-80022440 TTACTTCTTCCTTTCTCCTTTGG + Intergenic
1099230994 12:80025683-80025705 TTACCTTTCCCTTATTTCTGAGG + Intergenic
1099392283 12:82096726-82096748 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1099685733 12:85886054-85886076 TTCTCTTTTTCTTCTTCCTTTGG - Intergenic
1100741690 12:97600640-97600662 TTACTTTTTTCTTCTCTCTTTGG + Intergenic
1100881570 12:99024142-99024164 TTATATTTTCCTTCTCCCATAGG + Intronic
1100951461 12:99854433-99854455 TTAGATTTCTCTTCTTCCTTGGG - Intronic
1101029964 12:100648558-100648580 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1101257656 12:102994663-102994685 TTAACTTTTCTTCCATCCTTAGG + Intergenic
1104108712 12:125686876-125686898 TTACCATTTCCGTCTTCCAGTGG - Intergenic
1104126289 12:125849204-125849226 TTACCTTTCCCCTTTTCCTGGGG - Intergenic
1104526485 12:129528300-129528322 TTTCATTTTACTTCTGCCTTTGG - Intronic
1104668624 12:130665649-130665671 TTTCCTTGTCTTTCTTCCCTTGG - Intronic
1104786366 12:131451962-131451984 TCACTTTTTTCTTCTTCCTTTGG + Intergenic
1105947466 13:25202162-25202184 TTACCCTTTCCTTCCTGCCTTGG - Intergenic
1105948015 13:25206144-25206166 TTTCCTTCTCCTTCTTCTTCTGG - Intergenic
1105966415 13:25388707-25388729 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1106735382 13:32583724-32583746 TTACTATTTCCTTCTTCCAGAGG - Intergenic
1106894485 13:34283983-34284005 TTAGATTTATCTTCTTCCTTAGG + Intergenic
1107243997 13:38270550-38270572 CTAGCTTTTCTTTCTTCCTCTGG - Intergenic
1107256146 13:38428869-38428891 TTCCTTTTACATTCTTCCTTTGG - Intergenic
1107270121 13:38606434-38606456 TTTCCTTTTCCCTCTTCCTGTGG - Intergenic
1107367696 13:39702170-39702192 ATAACTTTTCTTCCTTCCTTAGG - Intronic
1107421321 13:40249523-40249545 TTACATTTTCCTCTTTGCTTGGG - Intergenic
1107560186 13:41551271-41551293 TCACTTCTTCCTCCTTCCTTTGG + Intergenic
1107583587 13:41819214-41819236 TTACCTTTTCCTTAATCACTTGG + Exonic
1108189082 13:47918587-47918609 TTACATTTCTCTTCTTCCTCGGG - Intergenic
1108299323 13:49058424-49058446 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1108407699 13:50122171-50122193 TTCTCCTTTTCTTCTTCCTTAGG + Intronic
1108626772 13:52236519-52236541 TTTCCCTTTCCCTCCTCCTTAGG - Intergenic
1108659297 13:52569966-52569988 TTTCCCTTTCCCTCCTCCTTAGG + Intergenic
1108791978 13:53980843-53980865 TTTCCTTCTCCTGCTTGCTTTGG + Intergenic
1108835433 13:54540575-54540597 CTATCTTTTACTTTTTCCTTTGG + Intergenic
1108942389 13:55973014-55973036 TAACATTTTCTTTATTCCTTTGG + Intergenic
1109824358 13:67698023-67698045 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1109851504 13:68071342-68071364 TTAGATTTTCCTTCTTCCCTGGG + Intergenic
1109918237 13:69020478-69020500 TTAGCTTTTCCTTAGTGCTTAGG - Intergenic
1110122884 13:71905132-71905154 TATTCTTTTCTTTCTTCCTTTGG + Intergenic
1110181973 13:72627527-72627549 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1110340790 13:74387855-74387877 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1110504864 13:76273300-76273322 TTAGATTTACCTTCTTCCTTGGG - Intergenic
1111106951 13:83658207-83658229 TTACTTTTTCCTTCTTAATTAGG + Intergenic
1111545732 13:89733328-89733350 TTTCATTTTCCTTCTCCTTTTGG + Intergenic
1111787143 13:92803066-92803088 TTTCCTTTTCCATTTTCCTAAGG - Intronic
1111813967 13:93127103-93127125 TTAACATTTTCTTCTTCTTTAGG - Intergenic
1111817555 13:93172927-93172949 ATATCTTTTTCTTCTTTCTTTGG - Intergenic
1111938912 13:94588039-94588061 TTATCTTTACCTTTTTCTTTAGG - Intronic
1111975588 13:94963732-94963754 GTACATTTTCCTTCTTCTTCGGG + Intergenic
1112137731 13:96601271-96601293 TTAACTTTTTCTTCTCCCTCAGG + Intronic
1112193625 13:97203015-97203037 TGAGCTTCTCTTTCTTCCTTTGG + Intergenic
1112765101 13:102733328-102733350 TTACTTTGTCCATCTTCCTTTGG + Exonic
1112939800 13:104847789-104847811 TTCCTTTTTCCTTCTCCCTGTGG - Intergenic
1113659941 13:112099629-112099651 TTAACTTTTCTTTCTCCTTTGGG + Intergenic
1114152108 14:20053456-20053478 TTACATTTTCTTTATTCCCTTGG - Intergenic
1114533179 14:23407972-23407994 TTCCATCTTCCTTCCTCCTTTGG - Intronic
1114627800 14:24140853-24140875 TAATCCTTTCCTTCTTCCTCTGG + Intronic
1115348278 14:32365870-32365892 CTACTATTTCCTTCTGCCTTAGG + Intronic
1115425115 14:33249579-33249601 TAACTCTTTCCTTCTTCCTGGGG + Intronic
1115700149 14:35945186-35945208 ATACCTGTTCTTTCTGCCTTAGG - Intergenic
1115809197 14:37087423-37087445 TTTCATTTTCCTTTTCCCTTTGG + Intronic
1116194930 14:41712656-41712678 TCACCTTCTCTTTCTTGCTTAGG - Intronic
1116922140 14:50590072-50590094 TTTCCTATTCTGTCTTCCTTTGG + Intronic
1117182353 14:53203714-53203736 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1117199872 14:53378546-53378568 TTACCTTTTCCTTTATCATCTGG - Intergenic
1117240845 14:53830729-53830751 TTAGATTTCCCTTCTTCCTCAGG - Intergenic
1117271505 14:54148121-54148143 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1117413290 14:55470124-55470146 TTTTCTTTTCTTTCTTCCTTTGG + Intergenic
1117419483 14:55530416-55530438 ATATCTGTTCCTTATTCCTTTGG + Intergenic
1117615022 14:57526057-57526079 TTAGTTTTATCTTCTTCCTTGGG + Intergenic
1118041798 14:61925121-61925143 TTATTCTGTCCTTCTTCCTTAGG - Intergenic
1118093173 14:62505518-62505540 TAACATTCTTCTTCTTCCTTTGG + Intergenic
1118736121 14:68703045-68703067 TCCCCATTTCCTTTTTCCTTGGG + Intronic
1118800973 14:69189503-69189525 TTTCCTGTTCTTTCTTCTTTGGG + Intergenic
1118982313 14:70726714-70726736 TTGCCTTTTCTTTCGTCCTTTGG - Intronic
1119245012 14:73097067-73097089 TTTCCTTCTTCTTCTTCCTGGGG - Exonic
1120476847 14:84999146-84999168 AGGCCTTTTCCTTCTTCCCTGGG + Intergenic
1120605320 14:86569356-86569378 TTAGACTTTTCTTCTTCCTTGGG + Intergenic
1120778758 14:88466565-88466587 TTCCCTTTTCCTTCTTTTTGGGG - Exonic
1120943582 14:89972755-89972777 TCACCTTTTCCTATTTCTTTTGG + Intronic
1121054157 14:90839284-90839306 TTTCTTTTTCCTTCATCCCTAGG - Intergenic
1121067489 14:90982461-90982483 TTATCTTTTTTTTCTTCCTTTGG - Intronic
1121106840 14:91285861-91285883 TTTCTTTTTCCTTCCTCCTTTGG - Intronic
1121162871 14:91761352-91761374 TTTGCTTTTTCTTCTCCCTTGGG - Intronic
1121808350 14:96853978-96854000 TTAGTTTTTCCTTTTTCCTTTGG + Intronic
1121894813 14:97637082-97637104 TTCCCTTTTCCTCCTGCCTCGGG + Intergenic
1122530804 14:102425400-102425422 TTACACTTTACTTTTTCCTTTGG + Intronic
1122644049 14:103179808-103179830 TTACCTTTCCCTGCTTCGTGGGG - Intergenic
1202839313 14_GL000009v2_random:106689-106711 TTTCTTTTTCCTTCTTCCTGGGG - Intergenic
1202908691 14_GL000194v1_random:96842-96864 TTTCTTTTTCCTTCTTCCTGGGG - Intergenic
1202884565 14_KI270722v1_random:92475-92497 TTTCTTTTTCCTTCTTCCTGGGG + Intergenic
1123694015 15:22863787-22863809 TCACCTCTGCCTTCTCCCTTGGG - Intronic
1124481199 15:30081761-30081783 TTTCTTTTTCCTTTTTCCTTAGG + Intergenic
1124776245 15:32592275-32592297 TTTCTTTTTCCTTTTTCCTTAGG + Intergenic
1125306062 15:38316036-38316058 TAACTGTTTTCTTCTTCCTTGGG + Intronic
1125535155 15:40438202-40438224 CCACCTCTTCCTCCTTCCTTCGG - Intergenic
1125846524 15:42859882-42859904 TTTTCTTTTCGTTCTTTCTTAGG - Intronic
1126922178 15:53540558-53540580 TTTTTTTTTCTTTCTTCCTTTGG - Intronic
1126950105 15:53871358-53871380 CTAACTTCTCCTTCTTACTTAGG + Intergenic
1126958905 15:53968150-53968172 TCACCTTTCCCTTCATCCTCAGG - Intergenic
1127090138 15:55458576-55458598 TTAGATTTCCCTTCTTCCTCAGG - Intronic
1127095775 15:55511088-55511110 TTAATTTTTACTTCTTTCTTTGG + Intergenic
1127105397 15:55608484-55608506 TTACTTTTTCCTTTTTTCTCGGG + Intergenic
1127163237 15:56214187-56214209 TAACTTTGTCCTTCTTCTTTAGG + Intronic
1127254644 15:57278998-57279020 TTTCCTTTTCTTTCTTCCTCAGG + Intronic
1127712859 15:61618646-61618668 TTACCTATTCATTCTTCCGTGGG - Intergenic
1127779069 15:62295573-62295595 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1128044443 15:64605226-64605248 ATACTGTTTCTTTCTTCCTTTGG - Intronic
1128502726 15:68239159-68239181 TTTCCTTTTTCTTCTGCATTGGG - Intronic
1128547195 15:68576347-68576369 AAACATTTTCCTTCTGCCTTTGG + Intergenic
1128697319 15:69777605-69777627 TTCCCTTTTCTCTCTTCCTCTGG + Intergenic
1128763692 15:70237469-70237491 AGACCTGTTCCTTCTTCCTCAGG - Intergenic
1129179485 15:73864312-73864334 TCCCCTTTTCTGTCTTCCTTTGG - Intergenic
1130176521 15:81577164-81577186 TTTGCTTGTCCTTCTCCCTTTGG - Intergenic
1130194131 15:81763101-81763123 ATACCCTTTCATTCTTTCTTAGG + Intergenic
1130852073 15:87804551-87804573 TTACCATTTCAGTCTTGCTTAGG + Intergenic
1131458912 15:92604832-92604854 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1131785679 15:95908934-95908956 TTCCCTTTTCCTTCTTCCCCAGG + Intergenic
1131923457 15:97355259-97355281 TTGCCTTTTCCACCTTCTTTTGG + Intergenic
1132000984 15:98179893-98179915 TTTCCATCTCCTTCTTCCTCTGG - Intergenic
1132297054 15:100746499-100746521 TTTTCTTTTCCTGCTTCCTATGG + Intergenic
1133115482 16:3575984-3576006 GTGCCACTTCCTTCTTCCTTCGG - Intronic
1133203187 16:4217150-4217172 ATGCCTTTTCTTTCTTCCTGGGG + Intronic
1134032961 16:11007308-11007330 TTGCCTTTTTCTTTTTCTTTTGG + Intronic
1134334654 16:13287088-13287110 TTACATTTTCCTTCTTCTAGTGG - Intergenic
1134486538 16:14663153-14663175 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1135036323 16:19080334-19080356 TTGCCTTTCCCTTCTTTTTTTGG - Intergenic
1135165543 16:20135802-20135824 TTTCCTTGTACTTCTTCCTATGG + Intergenic
1135645347 16:24156811-24156833 TTACCTTCTCCCTTTTCCATTGG + Intronic
1136600678 16:31285301-31285323 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1136670148 16:31849394-31849416 TTCCCTTTCCCTTCTTCTTGGGG + Intergenic
1137273259 16:46916942-46916964 TTTCTTTTTCCTTTTTCTTTTGG - Intronic
1137308739 16:47232054-47232076 TTACCTTTTCCAGCTTCTTGAGG - Intronic
1137374034 16:47936742-47936764 TTACTTTTTCATTCTTTCCTAGG + Intergenic
1137380568 16:47995218-47995240 TTACTTTGTTCTTCTTCCTCTGG - Intergenic
1137913524 16:52403598-52403620 TTTCCTATTCCTTCTTCCACAGG - Intergenic
1137914899 16:52419299-52419321 TTAATTTTCCCTTCTTCCTTTGG + Intergenic
1138246295 16:55469378-55469400 TTAGCCTTTCCTTCTACCCTGGG + Intronic
1138725628 16:59135597-59135619 TTCTCTTTTCTTTCTTCCTTTGG + Intergenic
1138755244 16:59476278-59476300 TTTCCTTTTCCTTTTCCTTTGGG - Intergenic
1138877537 16:60970890-60970912 TTAACTTTTGCTTCTGCTTTTGG + Intergenic
1139085696 16:63583000-63583022 TGACCTTTTCCTTTTTCCTTCGG + Intergenic
1139096193 16:63707178-63707200 TTTCCTTTTCCTCCTTGGTTAGG - Intergenic
1140036440 16:71375008-71375030 TTGTCACTTCCTTCTTCCTTGGG - Intronic
1140161593 16:72501185-72501207 TTGCCTTTTGCATCATCCTTTGG - Intergenic
1140548172 16:75832736-75832758 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1140805819 16:78531307-78531329 TTTCCTTTTTGTTTTTCCTTAGG + Intronic
1140861554 16:79022795-79022817 TTGCCTTTTCCATCATCCCTGGG - Intronic
1140870615 16:79103034-79103056 TTTCCATTTGCTTCTTGCTTTGG + Intronic
1140893608 16:79306076-79306098 TTACCTTTTCCAGCCTCCTTTGG - Intergenic
1141129238 16:81423974-81423996 CTTCCTTTGCCTTCTTCCCTGGG + Intergenic
1141827328 16:86489732-86489754 TTACCATTTTCTTCTTTCTCAGG - Intergenic
1141953540 16:87354623-87354645 GTATCTTTTCTTTTTTCCTTGGG - Intronic
1142910729 17:3088818-3088840 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1143227349 17:5317579-5317601 TTCCTTTTTCTTTCTTTCTTTGG - Intronic
1143412332 17:6717787-6717809 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1143772699 17:9178745-9178767 GGACATTTGCCTTCTTCCTTCGG + Intronic
1143891595 17:10106525-10106547 GTACTTTTTCCACCTTCCTTAGG + Intronic
1144312832 17:14028596-14028618 TTTCTTTTTCCTGCTTCCTTTGG - Intergenic
1144331924 17:14232731-14232753 TTTCTTTTTCCTGCTTCCTTTGG + Intergenic
1144660855 17:17069487-17069509 TTTTTTTTTCCTGCTTCCTTTGG + Intronic
1144674880 17:17155564-17155586 AAACCTTTGCCTTCTTCCTGCGG + Intronic
1144748629 17:17633251-17633273 TGTCCTTTCACTTCTTCCTTGGG - Intergenic
1145252188 17:21302715-21302737 TTCTATTTTCCTTTTTCCTTTGG - Intronic
1145828055 17:27892239-27892261 TTACCCTTTCCTACTTTATTTGG + Exonic
1145875115 17:28313124-28313146 TTACCAATTCCTTCTTTCATGGG + Intergenic
1145953277 17:28836809-28836831 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1146434166 17:32827793-32827815 TTACTTTTTCCTCATTGCTTTGG - Intronic
1146587119 17:34091973-34091995 TTTCCTTTCCCTACTTCCATGGG + Intronic
1146612989 17:34324756-34324778 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1146635159 17:34498634-34498656 GTGGCTTTTCCCTCTTCCTTTGG - Intergenic
1146753471 17:35404183-35404205 TTAGATTTTACTTCTTTCTTTGG + Intergenic
1146803231 17:35844258-35844280 TTATATTTTCCTCCTTTCTTAGG + Exonic
1146971413 17:37075451-37075473 TTCCCTTATTCTTCTTGCTTTGG + Intergenic
1148037540 17:44678945-44678967 TGTCCTGTTCCTTCTTCCTTTGG + Exonic
1148075193 17:44931729-44931751 GTGCCTTTTCCTTCCTCTTTAGG - Exonic
1148197669 17:45726385-45726407 TTTCCTTTTCCTTGTCCTTTTGG - Intergenic
1148550666 17:48548788-48548810 TGTCCTTGTCCTTCTTCCCTTGG + Intergenic
1149046734 17:52255085-52255107 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1149437786 17:56648279-56648301 TTTTCTTTTACTTCTTCCCTGGG + Intergenic
1149635028 17:58159974-58159996 TTATTTCTTCCATCTTCCTTGGG + Intergenic
1149674287 17:58445717-58445739 TTTCCTTTTCCTCCTTCCCCTGG - Intronic
1150175070 17:63046023-63046045 TTCACTTTTCCTAGTTCCTTGGG + Intronic
1150195069 17:63289536-63289558 TTTCTTTTTGGTTCTTCCTTAGG + Intronic
1150799423 17:68268695-68268717 TTTTCTTTTCTTTCTTCCTATGG - Exonic
1150870370 17:68902542-68902564 TTACCTATTCCTGCTTCTTTGGG + Intronic
1151590696 17:75042341-75042363 TTTCCTATCCCTTCTTCCTATGG + Intronic
1151741019 17:75982063-75982085 TTAACTTTCCCTCCTTCTTTTGG + Intronic
1152341344 17:79727329-79727351 TAACCTTTGCCTTCTTTCCTTGG - Intergenic
1152875091 17:82781865-82781887 TTTCCTTTTCCCTCTGCTTTGGG + Intronic
1153081854 18:1236895-1236917 ATACCTATTCTTTCTTTCTTGGG + Intergenic
1153086106 18:1289532-1289554 TTAGCTTTTGCTTCGTCTTTGGG + Intergenic
1153325315 18:3812597-3812619 AAACCTCTTCCTTCTTTCTTTGG - Intronic
1154044798 18:10894620-10894642 TTTCCTGATTCTTCTTCCTTTGG - Intronic
1154362773 18:13677643-13677665 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1155141223 18:23046422-23046444 TTTCCTTTTCCTTCTATTTTTGG - Intergenic
1155360141 18:24991528-24991550 TGAGCTTTTCCCTGTTCCTTGGG + Intergenic
1155525591 18:26713366-26713388 TTCCCTTTGCCTCTTTCCTTTGG + Intergenic
1155573691 18:27222763-27222785 TTAGATTTTTCTTCTTCCTTGGG + Intergenic
1155919400 18:31587892-31587914 TTGCTTTTTCCTTCATGCTTCGG + Intergenic
1155954854 18:31948384-31948406 TTAGTTTTTACTTCTTTCTTTGG - Intronic
1156249304 18:35336251-35336273 TTACCTATTTTTTATTCCTTTGG - Exonic
1156606991 18:38678687-38678709 TTAGCTTTCTCTTCTTTCTTGGG + Intergenic
1156698946 18:39800008-39800030 TGACCTTTTCCTTCCTTTTTTGG - Intergenic
1157009143 18:43625411-43625433 TTATCTGTTCCTACTTCCTTGGG + Intergenic
1157030725 18:43904361-43904383 TCACCTTTACCTTCTTCTATTGG + Intergenic
1157156436 18:45271309-45271331 TTATTTTTTCCTTTTCCCTTGGG + Intronic
1157318579 18:46616249-46616271 TTCCCTTTTATGTCTTCCTTTGG + Intronic
1157500119 18:48184576-48184598 CTACCTTCTCCTGCTTGCTTGGG + Intronic
1157556159 18:48614054-48614076 TTTCCTTTTCCTTCTGCCTCTGG + Intronic
1157863051 18:51158821-51158843 TTAGCCTTCACTTCTTCCTTGGG + Intergenic
1158104070 18:53864463-53864485 TTCAATTTTCCTTCTTCCCTTGG - Intergenic
1158164406 18:54523034-54523056 TTACATTTTCATTCTTACTTTGG + Intergenic
1158455933 18:57607688-57607710 TTTCCTTTTCCCTCTTTCTCTGG - Intronic
1159065299 18:63562631-63562653 TTGCTTTTTCCTTCTTTCATAGG + Intronic
1159247010 18:65819411-65819433 TTACCTTTGAATTCTTTCTTGGG + Intronic
1159453911 18:68637522-68637544 TTAGATTTTCTTTCTTCCTCAGG + Intergenic
1159572154 18:70128278-70128300 TTAAGTTTTACTTTTTCCTTAGG - Intronic
1159577753 18:70200549-70200571 TTACCTTTTCATTCATTGTTAGG - Intronic
1159578064 18:70204131-70204153 TGGACTTTTTCTTCTTCCTTCGG - Exonic
1159710458 18:71751613-71751635 TTCCTTTTTCCTGCTTGCTTTGG + Intronic
1159982711 18:74805179-74805201 TTTCCTTTTTCTTTTTACTTGGG + Intronic
1160058969 18:75512218-75512240 TTATATTTCCCTTCTTCCTCAGG - Intergenic
1160696562 19:487801-487823 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1162422322 19:10572895-10572917 TCACCTCTTCCTTATTCCATAGG - Exonic
1162838290 19:13336190-13336212 TTACTTTTTCCTTCTCCTTCTGG - Intronic
1163010693 19:14423865-14423887 TTAGCTTTTTTTTTTTCCTTTGG - Intergenic
1163186520 19:15642653-15642675 GTGTCTTTTCCTTCTGCCTTGGG + Intronic
1163499349 19:17666623-17666645 GTACCTCTTGATTCTTCCTTGGG - Intronic
1164016110 19:21257252-21257274 TTTCCTTTTCCTTTTCCCATAGG - Intronic
1164785277 19:30925646-30925668 TCACCTTTTCCCTCTAACTTGGG + Intergenic
1164820727 19:31249247-31249269 CTAGCTTTTCCTACTTCCTCAGG - Intergenic
1164859918 19:31554855-31554877 TCAAATTTCCCTTCTTCCTTGGG - Intergenic
1165322204 19:35092796-35092818 TTGGCTTTTACTTCTTTCTTTGG + Intergenic
1166803209 19:45470394-45470416 CTACCTCCTCCTTCTTCCTCGGG - Intronic
1167089864 19:47336506-47336528 TTTCTTTTTCTTTCTTTCTTGGG + Intronic
1167669685 19:50843211-50843233 TTAGATTTATCTTCTTCCTTGGG + Intergenic
1168246709 19:55116245-55116267 TTCCCTTTTCCTTCTCCTTCTGG - Intronic
1202633721 1_KI270706v1_random:23846-23868 TTTTTTTTTCCTTCTTCCTGGGG + Intergenic
1202652160 1_KI270707v1_random:16210-16232 TTTTTTTTTCCTTCTTCCTAGGG - Intergenic
1202659977 1_KI270708v1_random:59503-59525 TTTCTTTTTCCTTCTTCCTGGGG + Intergenic
925041432 2:734201-734223 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
925074178 2:998674-998696 TTTACTTTTTCTTCTTCCTCAGG - Intronic
925576817 2:5368910-5368932 TCTCCTTTTCTTTCTTTCTTGGG + Intergenic
925710166 2:6731420-6731442 TTCCCTCTTCCCTCTTCCTCTGG - Intergenic
926882804 2:17567084-17567106 TGACCTTTTGCTTTTTCATTTGG + Intronic
926902563 2:17770066-17770088 ATACCTTTCCTTTCTTGCTTGGG - Intronic
927051543 2:19334919-19334941 TTTCTTTTTCTTTCTGCCTTTGG - Intergenic
927176635 2:20414295-20414317 TTAGATTTTTCTTCTTCCTTGGG + Intergenic
927315171 2:21673483-21673505 TTCATTTTTCCTTCTTCCTTTGG - Intergenic
927791892 2:26016796-26016818 TTCACTTTGCCTTGTTCCTTGGG - Intergenic
927892245 2:26758838-26758860 TGACCTTGTCTTGCTTCCTTAGG + Intergenic
928048065 2:27958328-27958350 TTGTCTTTTCCTTCTCCCTCTGG - Intronic
928685302 2:33743559-33743581 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
928717504 2:34078648-34078670 TTAAATTTTACTTCTTCCTTTGG - Intergenic
928747907 2:34436261-34436283 TTACATTTTCCTTTTTCAGTTGG - Intergenic
928851399 2:35751446-35751468 TAACTTTTTCCTTCTTCATGTGG - Intergenic
929118368 2:38464066-38464088 TTACCTTGTTTTTTTTCCTTTGG - Intergenic
929141322 2:38669152-38669174 TTAGTTTTTACTTCTTTCTTTGG - Intronic
929178435 2:39005933-39005955 GTACCTTTTCCTTCCTTTTTAGG - Intronic
929211494 2:39362272-39362294 TTACTTTTTCCTTTTCACTTTGG - Intronic
929387953 2:41433659-41433681 TTACCTTTTTCTTTCTTCTTTGG + Intergenic
929387966 2:41433764-41433786 TTACCTTTTTCCTCTTTCTCTGG - Intergenic
929757383 2:44778870-44778892 TTCCCTTTTCTCTCTTCTTTGGG + Intergenic
930580780 2:53209297-53209319 TTTCTTTTTCCTTCAACCTTTGG + Intergenic
931186030 2:59952223-59952245 TTGCCTTTTCCTTTTTCCCCTGG - Intergenic
931535953 2:63276763-63276785 TTAGATTTCTCTTCTTCCTTGGG - Intronic
931601889 2:64012612-64012634 TTACCTCTTCCTGCTTCATCTGG + Intronic
931642074 2:64390617-64390639 TTATTATTTCCTTCTTTCTTTGG + Intergenic
931801279 2:65760464-65760486 CTTCCTACTCCTTCTTCCTTTGG - Intergenic
932025293 2:68126103-68126125 TTAGTTTTTCTTTTTTCCTTTGG - Intronic
932192642 2:69753810-69753832 CTACACCTTCCTTCTTCCTTAGG - Intronic
932528043 2:72494212-72494234 TTACTTTTTCTATCTTCTTTTGG - Intronic
933062121 2:77750758-77750780 TTTCCTTTTCCTGTTTACTTTGG + Intergenic
934168693 2:89321019-89321041 TTACCTTGGCCTTCTTCCTTTGG - Intergenic
934198597 2:89861564-89861586 TTACCTTGGCCTTCTTCCTTTGG + Intergenic
934790898 2:97059177-97059199 TTACCTTGTTCTTCTTCCTGTGG + Intergenic
934815553 2:97323353-97323375 TTACCTTGTTCTTCTTCCTGTGG - Intergenic
934822142 2:97385130-97385152 TTACCTTGTTCTTCTTCCTGTGG + Intergenic
935241944 2:101186505-101186527 TTAGTTTTTACTTCTTTCTTTGG + Intronic
935543311 2:104374986-104375008 TTTCCTTTTTCTTAGTCCTTAGG + Intergenic
935922410 2:108030747-108030769 TTCCCATTTCCTTCTTCCAGGGG - Intergenic
935980853 2:108625458-108625480 TTCCCTTTTCCCTGTTCCTTCGG + Intronic
937212974 2:120289471-120289493 TTTTTTTTTCCTTCTGCCTTAGG + Intronic
937828821 2:126398304-126398326 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
938132274 2:128726777-128726799 TTTCTTTTGCCTTCTCCCTTAGG - Intergenic
938261949 2:129902927-129902949 TGACATTGTCCTTCCTCCTTAGG - Intergenic
938354523 2:130631132-130631154 TCACGTTTTTTTTCTTCCTTGGG + Intronic
938430945 2:131237917-131237939 TCACGTTTTTTTTCTTCCTTGGG + Intronic
938592068 2:132749198-132749220 TTTCATTTTCTTTCTTACTTTGG + Intronic
938717877 2:134037331-134037353 TTACTTTTTCTTCCTTTCTTAGG - Intergenic
938915354 2:135933167-135933189 TTATCTGTTCCTTCAACCTTGGG - Intronic
938917909 2:135962481-135962503 TTCCTTTTTCTTTCTTCTTTTGG - Intronic
939948715 2:148442566-148442588 TTACCTTATCTTTCTTTCTCTGG - Intronic
940340975 2:152581120-152581142 TTACCTTTTCATTTATCCTAGGG + Intronic
940363244 2:152818148-152818170 TTACTTTTTCTTTCTTCTTATGG + Intergenic
940423561 2:153506945-153506967 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
940657101 2:156500991-156501013 TCTCCTTTTCCAGCTTCCTTTGG - Intronic
940953733 2:159706220-159706242 TTTTCTTTTCCTTCTTAATTTGG - Intergenic
941227847 2:162870268-162870290 TTTCCTTTTCCTTGATCTTTGGG - Intergenic
941756322 2:169190445-169190467 TCACCTCCTCCTTCTTCCTCAGG + Intronic
941790063 2:169542433-169542455 TTTCCTTTTCCTTTTTATTTTGG - Intronic
942179871 2:173370317-173370339 TTACGTTTTGATTCTTACTTAGG + Intergenic
942914374 2:181285437-181285459 TTCTCTTTTCCTTGATCCTTTGG + Intergenic
943149863 2:184098459-184098481 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
943183516 2:184575302-184575324 TTTCCTTTTCATTCTTTCCTAGG - Intergenic
943194986 2:184735229-184735251 TTTCCTTTTCTTTCTTACATAGG + Intronic
943196945 2:184765348-184765370 TTAGTTTTTACTTCTTTCTTTGG - Intronic
943389118 2:187240350-187240372 TTATTTTATCCTGCTTCCTTTGG - Intergenic
943454635 2:188089715-188089737 TTACTTATTTCTTTTTCCTTTGG - Intergenic
943607139 2:189988903-189988925 TTCTCTCTTTCTTCTTCCTTTGG + Intronic
944064594 2:195605362-195605384 TTCCCATTTCTTTCTTCTTTGGG - Intronic
944322783 2:198367236-198367258 ATTCCTTTTCCTTCTTTCCTCGG - Intronic
944448511 2:199817184-199817206 ATACCTTTTACTATTTCCTTAGG + Intronic
944485531 2:200201095-200201117 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
945123834 2:206486882-206486904 TCCCCATTCCCTTCTTCCTTAGG + Intronic
945141164 2:206687583-206687605 TTTGTTTTTCTTTCTTCCTTAGG + Intronic
945362456 2:208907878-208907900 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
945477879 2:210306859-210306881 TTATCTTCTCTCTCTTCCTTGGG + Intronic
945482443 2:210359770-210359792 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
945504718 2:210625630-210625652 TTCTCTCTTCCTTCTTCCTTTGG - Intronic
945997614 2:216451170-216451192 TAACCTTTTCCCTCTTCCCTAGG + Intronic
946105371 2:217364819-217364841 TTTCCTCTTCTCTCTTCCTTTGG - Intronic
946125182 2:217556497-217556519 TTTCTTTCTGCTTCTTCCTTGGG + Intronic
946275243 2:218626814-218626836 TTACCTGTATTTTCTTCCTTGGG - Intronic
946467243 2:219922812-219922834 TTGCCTTGGCCTTCTTCCTTGGG + Intergenic
946469909 2:219949348-219949370 TTATCCATTTCTTCTTCCTTAGG - Intergenic
946764860 2:223031130-223031152 TTTCTTTTTTCTTTTTCCTTGGG + Intergenic
946782181 2:223203466-223203488 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
946967181 2:225048790-225048812 TAATCTTTTCCTTCTTCATATGG - Intergenic
947102353 2:226634896-226634918 TTAAATTTTCCATCTTCCTTGGG + Intergenic
947148978 2:227095105-227095127 TTACCTTTTCCCCATTCTTTAGG + Intronic
947312410 2:228818594-228818616 ATACCATTTCCTTCTGCCTGAGG - Intergenic
947878140 2:233481199-233481221 TTACCTTTTCCTTCTCCCCAGGG + Exonic
947957116 2:234201620-234201642 TTACCAGTTTCCTCTTCCTTGGG - Intergenic
948287164 2:236794953-236794975 CCGCCTTTTCCCTCTTCCTTGGG + Intergenic
948531333 2:238607792-238607814 TTAGCTTTCTCTTCTTCCTCAGG - Intergenic
948609882 2:239159930-239159952 TTTGCTTTTCCATCTTCCTCCGG - Intronic
1168872394 20:1141606-1141628 TTATCCTTGCCTTCTTCCTTAGG - Intronic
1169182301 20:3580314-3580336 GTACCCTTTCTCTCTTCCTTAGG + Intronic
1170019539 20:11820783-11820805 TTTCCTTTTCTTTTTCCCTTTGG + Intergenic
1170124853 20:12951151-12951173 TTACCTTAGCCTTCTTCTGTGGG + Intergenic
1170323118 20:15123257-15123279 TTAGTGTTTCCTTCTTCCTAAGG - Intronic
1170546454 20:17439047-17439069 TTAGGTTTCCCTTTTTCCTTTGG + Intronic
1171259229 20:23717100-23717122 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1171378507 20:24713764-24713786 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
1171474387 20:25396712-25396734 TTCCATTTTCCTTCTTCCAGGGG + Intergenic
1171815099 20:29779091-29779113 TTCCCTTTACCTTCTTCTTGTGG - Intergenic
1171896614 20:30814724-30814746 TTAGATTTTACTTCTTTCTTTGG - Intergenic
1171903341 20:30877631-30877653 TTCCCTTTACCTTCTTCTTGTGG + Intergenic
1172313963 20:33939215-33939237 TTGGCTCTTCCTCCTTCCTTGGG - Intergenic
1172413204 20:34741944-34741966 TTACCTGTTCCTTCCTACTCTGG + Exonic
1172714519 20:36952840-36952862 TTACTTTTTCCTACATCCTAAGG - Intergenic
1172745104 20:37200936-37200958 TTCCCTTGTACTTCTTCCTGGGG - Intronic
1173468568 20:43303967-43303989 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1174097095 20:48098060-48098082 CTACCCTCACCTTCTTCCTTGGG - Intergenic
1174350922 20:49967262-49967284 TTACTTATTCCTTATTCCATAGG - Intergenic
1174727971 20:52884381-52884403 TTCTCTTTTCCTACCTCCTTTGG + Intergenic
1175977753 20:62720663-62720685 TTTCCTTTTTCTGCTTGCTTTGG + Intronic
1176172290 20:63701437-63701459 TTACCTGTTCCTGCTACCCTTGG - Intronic
1176294064 21:5061252-5061274 TCCCCTTTCTCTTCTTCCTTGGG + Intergenic
1176599992 21:8783443-8783465 TTTTTTTTTCCTTCTTCCTAGGG + Intergenic
1176628051 21:9111505-9111527 TTTCTTTTTCCTTCTTCCTTGGG - Intergenic
1176889033 21:14292136-14292158 TTACCTTTTCCTTTCTCCTCTGG + Intergenic
1177470603 21:21556592-21556614 TTATCTTCTCCTTCTAGCTTTGG + Intergenic
1177800333 21:25822505-25822527 TTAGCTGTTACTTCTTCTTTAGG + Intergenic
1178072234 21:28981270-28981292 TTAGCTTCTCTTTCTTCCTCTGG + Exonic
1178201317 21:30409192-30409214 TTTCCCCTTCCTACTTCCTTAGG - Intronic
1178253230 21:31024877-31024899 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1178708374 21:34891615-34891637 TTTCCTTTCCTTTCTCCCTTAGG - Intronic
1179166209 21:38937135-38937157 TTGCCCTTTCCTTCCTCCTGTGG - Intergenic
1179198094 21:39183996-39184018 TTCCATTTTCCTTCTGCGTTAGG + Intergenic
1179467637 21:41588026-41588048 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1179863195 21:44202396-44202418 TCCCCTTTCTCTTCTTCCTTGGG - Intergenic
1180152180 21:45954943-45954965 TTCCCTTTTTCTTATTACTTTGG + Intergenic
1180318534 22:11299644-11299666 TTCCCTTTACCTTCTTCTTGTGG - Intergenic
1180327453 22:11443084-11443106 TTTCTTTTTCCTTCTTCCTGGGG + Intergenic
1180336736 22:11583589-11583611 TTCCCTTTACCTTCTTCTTGTGG + Intergenic
1180379098 22:12121907-12121929 TTTTTTTTTCCTTCTTCCTGGGG + Intergenic
1180418428 22:12791418-12791440 TTTTTTTTTCCTTCTTCCTAGGG - Intergenic
1181876206 22:25942904-25942926 TTTCCTTTCCCTTCTTTCCTTGG - Intronic
1183160813 22:36111705-36111727 TGACCTTTTATTTCTTCATTGGG - Intergenic
1183811339 22:40260368-40260390 TCATCTTTTCTTTCTTCCTTAGG - Intronic
1184335846 22:43852599-43852621 TCACCTTTTCCTTTTCCTTTTGG - Intronic
1184891608 22:47382796-47382818 TTTTCATTTCCTACTTCCTTTGG - Intergenic
1185163267 22:49242531-49242553 CTACAGTTTCCTTCTTCCCTGGG - Intergenic
1185252084 22:49808281-49808303 TTACCCATTCCTTCCTCCATGGG - Intronic
949094633 3:71552-71574 TTACCTTTTTATTCTTTCTTTGG + Intergenic
949451605 3:4191394-4191416 TAACCTTTTACTTCTTCATTTGG - Intronic
949589229 3:5476040-5476062 TTACCTTTACTTTCCTCCATGGG + Intergenic
949615090 3:5744932-5744954 TTAACTTTTTCCTCTTCCCTGGG + Intergenic
949793894 3:7824510-7824532 ATACCTTTTCCCTCTTCTTCTGG - Intergenic
949824226 3:8148092-8148114 TTAATTTTTCCTTCCTCCTGAGG - Intergenic
950504317 3:13384780-13384802 TCCCCTTTGCATTCTTCCTTAGG + Intronic
951023581 3:17806522-17806544 TTACCTTTTCTGTCTCCCCTTGG + Intronic
951273202 3:20653077-20653099 TTATCTTTTCTTCCTTCTTTGGG - Intergenic
951546212 3:23828895-23828917 GGACATTTTCCCTCTTCCTTAGG - Intronic
951792858 3:26505440-26505462 TTTCCTTTTCCTCCTTCCTGTGG + Intergenic
951792928 3:26506391-26506413 TTTACTTTTTCTTTTTCCTTAGG - Intergenic
951855821 3:27196029-27196051 TTAGTTTTTACTTCTTTCTTTGG - Intronic
951967259 3:28400325-28400347 TTAAATTTCTCTTCTTCCTTAGG - Intronic
952007422 3:28857948-28857970 TTACCTCTTCCGTCTGGCTTAGG + Intergenic
952511611 3:34063657-34063679 TTATGATTTTCTTCTTCCTTGGG + Intergenic
952703368 3:36349782-36349804 TTAGATTTCCCTTCTTCTTTTGG - Intergenic
952913400 3:38210445-38210467 TTACTTTTTTCTTCCTCCTGTGG + Intronic
952959726 3:38581761-38581783 TTACCTCTTCCTGCTGCCTTAGG + Intronic
953383982 3:42494736-42494758 TTACTAATTCCTTCTTTCTTTGG + Intronic
953524592 3:43678356-43678378 TTAGTTTTTACTTCTTTCTTTGG - Intronic
953640709 3:44704851-44704873 TTTGCTTTTCCTTTTTCTTTGGG - Intergenic
953892870 3:46767309-46767331 TTCTCTTTTTCTTCTTCTTTTGG - Intronic
954008129 3:47609554-47609576 TTATCTTTTCCTCCTCACTTTGG - Intronic
954502683 3:51034308-51034330 TTCCCTTTTGCATCTTCTTTTGG + Intronic
954896894 3:53983065-53983087 TCTCCTTTTCCTTCAGCCTTGGG + Intergenic
955450616 3:59063446-59063468 TTAGATTTATCTTCTTCCTTGGG + Intergenic
955461480 3:59188603-59188625 TTAGATTTATCTTCTTCCTTGGG + Intergenic
955753773 3:62207754-62207776 TTCCCTTCTTCTTCTTCCCTGGG - Intronic
956063043 3:65368028-65368050 TGAACTTTTACTTCTTCATTTGG + Intronic
956162268 3:66367645-66367667 TTTCCTTTTCTTCCTTTCTTGGG + Intronic
956169117 3:66418997-66419019 TTTTCTTTTCTTTTTTCCTTTGG - Intronic
956302085 3:67782850-67782872 TTTCCTTTTGCTTCTTCCAGTGG + Intergenic
956303890 3:67803423-67803445 TGAACTTTTTCTTCTCCCTTAGG + Intergenic
956955393 3:74332918-74332940 TTAACAATTTCTTCTTCCTTGGG - Intronic
957391795 3:79583518-79583540 TCATCATTTTCTTCTTCCTTAGG - Intronic
958064407 3:88524928-88524950 TTAGGTTTACATTCTTCCTTGGG + Intergenic
958490370 3:94765260-94765282 TTAGCTTTCTCTTCTTCCTCAGG + Intergenic
958563270 3:95776151-95776173 TCACATTTTCCTTTCTCCTTTGG - Intergenic
958711347 3:97720729-97720751 TTACTTTTCGTTTCTTCCTTAGG + Intronic
959262773 3:104102766-104102788 TGACCTTTTACTTGTTTCTTGGG + Intergenic
959499199 3:107086262-107086284 TTACTTTTTTGTTCTTACTTTGG + Intergenic
959794585 3:110410036-110410058 TTTCCTCTTCCTTCTTACTTTGG + Intergenic
960185062 3:114628111-114628133 TTTCCTTTTTTTTCTCCCTTTGG + Intronic
960210525 3:114959458-114959480 ATGTCTTTTCTTTCTTCCTTTGG - Intronic
960286752 3:115838570-115838592 ATATCTTTTTCTTCATCCTTGGG - Intronic
960379420 3:116940783-116940805 TTTTCTTTTTCTTCTTCCTCAGG - Intronic
960761892 3:121080966-121080988 TTAGATTTTTCTTCTTCCTCAGG + Intronic
962013045 3:131411915-131411937 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
962034573 3:131637577-131637599 TTAGATTTCTCTTCTTCCTTGGG - Intronic
962135928 3:132731947-132731969 TTCCCTTCTGCTTGTTCCTTGGG + Intergenic
962182655 3:133224883-133224905 TCACTTTATCCTTCATCCTTAGG + Intronic
962328261 3:134454081-134454103 TCATCTTTTCCTCCTTCCTGGGG + Intergenic
962709558 3:138074095-138074117 TTAGATTTCTCTTCTTCCTTGGG - Intronic
962769661 3:138600700-138600722 TTAACTTTTCCTTTTTATTTTGG + Intergenic
962821376 3:139050547-139050569 ATAGCTTTTCCTTCTTTCTCTGG + Intronic
962914522 3:139887797-139887819 TTACCTTTTCCAGCTTCCAGAGG + Intergenic
963051094 3:141144674-141144696 ACTCCTTTTCCTTCTTCCTTTGG + Intronic
963231448 3:142912106-142912128 TCACCTTTTCATTCCTTCTTTGG + Intergenic
963373747 3:144437000-144437022 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
963429509 3:145180827-145180849 TTACCTTTGAATTCTTTCTTGGG - Intergenic
963542516 3:146611125-146611147 TTACCTTTGCCTTCGTTCTTGGG + Intergenic
963594840 3:147313217-147313239 TTACATTTTCCTTCTTTATTTGG - Intergenic
964221717 3:154354560-154354582 TTTCCTTTTCCTTTTTTTTTTGG + Intronic
964523110 3:157587936-157587958 TTAGTTTTTACTTCTTTCTTTGG + Intronic
964527892 3:157634689-157634711 TTAATTTTTCCTTGTTCATTTGG + Intronic
964851185 3:161097858-161097880 TTACATTTTTCTCCTTACTTTGG + Intronic
965101710 3:164307076-164307098 TTAGATTTCCCTTCTTCCTTGGG - Intergenic
965154168 3:165025385-165025407 TTAGATTTCCCTTCTTCCTCAGG - Intronic
965184696 3:165447657-165447679 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
965358144 3:167703163-167703185 ATTACTTTTCCTTCTTCTTTTGG + Intronic
965978099 3:174650928-174650950 TTATCTTTTCCTTATGCATTTGG + Intronic
966019927 3:175196182-175196204 TTATCTTTTCCTTCAAGCTTTGG + Intronic
966551945 3:181215146-181215168 AAACCCTTCCCTTCTTCCTTGGG + Intergenic
966650641 3:182296950-182296972 ATACATTTTCCTTTTTGCTTAGG - Intergenic
966976273 3:185086136-185086158 TCACCTTTTCCCTCTATCTTTGG - Intronic
967235522 3:187380028-187380050 TTTCCTTTTGCTTTTTCCCTTGG - Intergenic
967434996 3:189433195-189433217 TTTGCTTTTCCTTCTCCCTCAGG - Intergenic
967504723 3:190240510-190240532 TTAGATTTCTCTTCTTCCTTAGG - Intergenic
967659341 3:192086534-192086556 TTTCCTTTTGATTCTTTCTTAGG + Intergenic
968383276 4:112751-112773 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
968435529 4:585692-585714 TTTCCTTTTTCTGCTTACTTTGG + Intergenic
968749228 4:2378593-2378615 ATGCTTTTTCCTTCTTTCTTAGG + Intronic
969452001 4:7279359-7279381 TCATCTTTTCCTTATTACTTTGG - Intronic
969924645 4:10574674-10574696 TTAGTTTTTACTTCTTTCTTTGG - Intronic
970394387 4:15651481-15651503 TTCCCTTTTCCTTCTTCCACAGG + Intronic
970491464 4:16579383-16579405 TTATCTTTTTCTATTTCCTTTGG - Intronic
971050278 4:22854410-22854432 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
971541923 4:27829065-27829087 ATTCCTTTTCTTTCTTCCATGGG - Intergenic
971576517 4:28281429-28281451 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
971709985 4:30098157-30098179 TTGCATTTTCCTTCTACATTTGG + Intergenic
971947045 4:33292965-33292987 TTTCTTTTGCCTTCTTCTTTCGG + Intergenic
972617540 4:40714662-40714684 TTACCTCTTCCTTGTTTGTTTGG + Intergenic
973342923 4:49024956-49024978 TTAGATTTTTCTTCTTCCTTGGG + Intronic
973363356 4:49185861-49185883 TTTTTTTTTCCTTCTTCCTAGGG + Intergenic
973397740 4:49610996-49611018 TTTTTTTTTCCTTCTTCCTAGGG - Intergenic
973545864 4:51981476-51981498 CTACCACTTCCTTCTTCCCTGGG - Intergenic
973798952 4:54457676-54457698 TTACCTGTTCCTCCATCCTGTGG + Intergenic
973920236 4:55676697-55676719 TTAAATTTCTCTTCTTCCTTGGG - Intergenic
974003697 4:56535277-56535299 TTAGTTTTTACTTCTTTCTTTGG - Intronic
974387652 4:61223707-61223729 TTACCTTGTCATTCTTACATTGG + Intronic
974944273 4:68507694-68507716 TTACCTCTGCCTTTGTCCTTTGG + Intergenic
974961801 4:68711576-68711598 TTCCCTTCTCCTTCCTCCGTTGG + Intergenic
974992505 4:69112020-69112042 TTAGTTTTTACTTCTTTCTTTGG - Intronic
975178785 4:71319242-71319264 TTTCCTTTTCATTCTGTCTTTGG + Intronic
975653879 4:76621549-76621571 TTTCTTTTTCCTTCCACCTTAGG + Intronic
975858799 4:78654043-78654065 ATACCTTTTACATATTCCTTTGG + Intergenic
976917340 4:90393211-90393233 TTACATTTGCCTTTTTACTTGGG - Intronic
976962972 4:91002357-91002379 TTACATTTCCCTTCTTCCTCAGG + Intronic
977025458 4:91813248-91813270 TTCCCTTTTCCTTCTTTTTCGGG - Intergenic
977122208 4:93116498-93116520 TTACTTTTTTCTTCATCTTTGGG + Intronic
977610331 4:99024000-99024022 TTAGTTTTTACTTCTTTCTTTGG - Intronic
977643081 4:99379210-99379232 TTGACTTTTCCTTCTGGCTTAGG + Intergenic
977803859 4:101272921-101272943 TTAGCTTTTCGTTCTTACCTGGG - Intronic
977813750 4:101389340-101389362 TTATATTTGTCTTCTTCCTTAGG + Intergenic
977905838 4:102476809-102476831 TTAGATTTTTCTTCTTCCTCAGG - Intergenic
977971977 4:103223675-103223697 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
977975998 4:103267740-103267762 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
978189125 4:105893290-105893312 ATTCCTCTTCCTTCTTCATTTGG - Intronic
978201840 4:106031746-106031768 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
978675137 4:111304844-111304866 TAACATTTTCCTTTTTCATTTGG + Intergenic
978708095 4:111741376-111741398 TCATCTTTTCCCTTTTCCTTTGG + Intergenic
978928089 4:114274988-114275010 TTTCCTTTTGATTCTTTCTTAGG + Intergenic
979014297 4:115413004-115413026 TTAAGTTTTCCTTTTTCCTCTGG - Intergenic
979030037 4:115632403-115632425 TTAGGTTTTTCTTCTTCCTCTGG + Intergenic
979422934 4:120528885-120528907 TTTCCTTTTCCAGCTTCCTGTGG + Intergenic
979682623 4:123478463-123478485 TTACCCTTTCCAGCTTGCTTTGG - Intergenic
979729286 4:124004281-124004303 TTCTCTTTTCCTTCTTTTTTTGG + Intergenic
979816367 4:125111020-125111042 TTTCCTATGCCTCCTTCCTTTGG + Intergenic
979871334 4:125826188-125826210 TTTCCTTTACCATCATCCTTTGG - Intergenic
980860935 4:138498956-138498978 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
981167824 4:141582583-141582605 TTAGCTCTCTCTTCTTCCTTGGG - Intergenic
981490218 4:145331499-145331521 TGACCTTTTCCCTTTTCCTAGGG + Intergenic
982029978 4:151291096-151291118 TTACCTTTCATTTCTTCCTTAGG + Exonic
982050015 4:151491027-151491049 TTAGATTTTTCTTCTTCCTTAGG - Intronic
982311221 4:153987268-153987290 TTACATCTTCCTTCTTTTTTTGG - Intergenic
982415705 4:155129020-155129042 TTACCTTTTCGCTCTTATTTAGG + Intergenic
983072625 4:163287362-163287384 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
983074552 4:163309704-163309726 TTTCCTTTTCATGCTTCCTGTGG - Intergenic
983205295 4:164904694-164904716 TTACTTTTTCCTTTTTCTTTGGG - Intergenic
983277580 4:165636794-165636816 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
983786280 4:171733719-171733741 TTTCCTTTTACTTTTTTCTTAGG - Intergenic
983807692 4:172016168-172016190 TTAGCTTTCTCTTCTTCCTCAGG + Intronic
983971405 4:173879549-173879571 ATTCCTTTTCTTTCTTCCTGCGG + Intergenic
984348241 4:178559312-178559334 TTACCCTTGACTTCTTCCATAGG - Intergenic
984357994 4:178689860-178689882 TTGACTTTTTTTTCTTCCTTAGG - Intergenic
984562619 4:181288659-181288681 TCACCTTTTCCTTATTCTGTTGG - Intergenic
984727885 4:183038673-183038695 TTGCTTGGTCCTTCTTCCTTTGG + Intergenic
1202760715 4_GL000008v2_random:107386-107408 TTTTTTTTTCCTTCTTCCTGGGG + Intergenic
985958431 5:3281744-3281766 CTTCCTTTTCCTTCTTCCCTGGG - Intergenic
986489702 5:8276641-8276663 ATACCTTTTCATACTTGCTTTGG - Intergenic
986731092 5:10635671-10635693 TTGCCTGTTCCTTCTTCTTTTGG + Intronic
986902894 5:12458891-12458913 TTACCTTGTGATTCTTCTTTTGG + Intergenic
987030270 5:13970891-13970913 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
987128196 5:14835010-14835032 TAACCTTTTCTTTCCTACTTTGG - Intronic
987194341 5:15510518-15510540 ATACCTTCTTCTTCTTCCTGGGG - Intronic
987788462 5:22533101-22533123 TTTCTTTTTCCTTCATCCATTGG + Intronic
988206624 5:28144514-28144536 TTCCCTTTTTCTACTTCCTTGGG + Intergenic
988313893 5:29598811-29598833 GTAGCTTTTTTTTCTTCCTTTGG + Intergenic
988652239 5:33165707-33165729 TTAGGTTTCCCATCTTCCTTGGG + Intergenic
988697447 5:33637094-33637116 TTCCCTTTTCTTTCTTCTTGTGG + Intronic
988820217 5:34876236-34876258 TTATTTTTTTCTTCTTACTTTGG - Intronic
988876005 5:35446471-35446493 TTAGATTTTTCTTCTTCCTCAGG - Intergenic
988938239 5:36113075-36113097 TTAGTTTTTACTTCTTTCTTTGG - Intronic
989014066 5:36908856-36908878 ATTCCTTTACCTTGTTCCTTAGG - Intronic
989073019 5:37532364-37532386 TTAGATTTCTCTTCTTCCTTAGG + Intronic
989096456 5:37786087-37786109 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
989384494 5:40841317-40841339 TTAACTTTTACTTATTCATTAGG + Exonic
989727589 5:44604930-44604952 TTAGATTTATCTTCTTCCTTGGG - Intergenic
989951612 5:50305981-50306003 TTACTTTCTCCTGCTTTCTTTGG - Intergenic
990313727 5:54564952-54564974 TTCCCTTTTCCATCTTCTTGAGG + Intergenic
990571226 5:57081010-57081032 TTCTCTTTTTCTTCTTCTTTTGG + Intergenic
990883459 5:60565781-60565803 TCTCCTGTCCCTTCTTCCTTTGG - Intergenic
991040681 5:62172146-62172168 TTACATGTTTATTCTTCCTTGGG + Intergenic
991400987 5:66251403-66251425 TTTCTTTTTCCCTCCTCCTTAGG - Intergenic
992168189 5:74075606-74075628 TTTCCTTTTCCTTCTTGTTAAGG + Intergenic
992661570 5:78967228-78967250 TTACCTTCTCCTTCTCCCAAAGG + Intronic
992857795 5:80881041-80881063 TCACCTTTTCCTTCCTCATATGG + Intergenic
993003185 5:82403392-82403414 TTCCGTATTCTTTCTTCCTTCGG + Intergenic
993033515 5:82731242-82731264 TTACCGTTTCCTGCCTCCCTGGG - Intergenic
993558212 5:89368121-89368143 TTACCTTTTACATCTTCTGTTGG + Intergenic
993635926 5:90343634-90343656 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
993646347 5:90468298-90468320 TTAGATTTATCTTCTTCCTTGGG + Intronic
993815367 5:92538111-92538133 TTACTTTTTTTTTCTTCTTTAGG + Intergenic
993827962 5:92716013-92716035 TTCCCTTTTATTTCTTCCTTTGG - Intergenic
994304179 5:98181766-98181788 TTAGATTTCTCTTCTTCCTTAGG - Intergenic
994554534 5:101281907-101281929 TTACCTTTTCCTAGCTGCTTTGG + Intergenic
994568231 5:101481867-101481889 TTACATTTATCTTCTTCCTCAGG + Intergenic
994943477 5:106355732-106355754 TTTCTTTGTGCTTCTTCCTTAGG + Intergenic
994955967 5:106532753-106532775 TTACCTTTTCCTTTTTGATATGG + Intergenic
995574733 5:113517566-113517588 TTTCCTTTTTCTTCTTTCTCTGG - Intronic
995839836 5:116433187-116433209 GTACCTTTTGTTACTTCCTTTGG - Intergenic
995915883 5:117243988-117244010 TTTGCTTCTCCTTCTTCCTTTGG + Intergenic
995946758 5:117657123-117657145 TTTTCTTTTCCTTCTTTGTTAGG + Intergenic
996031457 5:118709919-118709941 CTACCTTGTTCTTCTTCTTTAGG - Intergenic
996040204 5:118800797-118800819 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
996045093 5:118862944-118862966 ATCCCTTTTTCTTCTTGCTTTGG + Intronic
996056009 5:118983573-118983595 TTACCTTTTCCTTATTCTTTAGG - Intronic
996235477 5:121124676-121124698 TTATTTTTTCCATCTTCCATTGG + Intergenic
996427344 5:123329250-123329272 TTAGATTTCCCTTCTTCCTCAGG + Intergenic
996495169 5:124147519-124147541 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
996848584 5:127928340-127928362 TTGTCTTTTCCATCTTCTTTAGG + Intergenic
996875246 5:128234055-128234077 TTAGATTTTTCTTCTTCCTTGGG + Intergenic
997058585 5:130474405-130474427 TTATTTTTTTCTTCTTCTTTTGG + Intergenic
997181572 5:131834003-131834025 TTAACTTTTACTTATTTCTTAGG - Intronic
997798205 5:136832994-136833016 TTAGATTTTTCTTCTTCCTCTGG + Intergenic
997992622 5:138558360-138558382 TTGCTTTTTCCTTGTGCCTTAGG - Intronic
998494712 5:142577974-142577996 CTACCTGTTCCTGCTTCCTGAGG + Intergenic
998986982 5:147769758-147769780 TTGCCTTTTCCTTCTGTCTAGGG + Intronic
999143310 5:149376993-149377015 TTACCATTTCCATCTTCCTGGGG - Exonic
999204122 5:149836237-149836259 TTACCTTTCTCCTCTTCCTCGGG + Intronic
999337651 5:150736145-150736167 TTAGATTTCTCTTCTTCCTTGGG - Intronic
999446122 5:151640844-151640866 TTTCCTTTTCCTGCAGCCTTTGG + Intergenic
999843924 5:155457791-155457813 TTCCCTTTGCCTTCTGCCTGAGG + Intergenic
1000236457 5:159366240-159366262 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1000237237 5:159373463-159373485 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1000402056 5:160839537-160839559 TTTGCTTTTCCTTTTCCCTTTGG - Intronic
1001224676 5:169933601-169933623 TTCCCTTTTCTTCCTTCGTTCGG + Intronic
1001439854 5:171734300-171734322 TTACCCTTTCCTTCTGAGTTGGG - Intergenic
1001611428 5:173005681-173005703 TTATTTCTTCCTTCTTACTTTGG + Intronic
1001693632 5:173652993-173653015 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1001943617 5:175759046-175759068 TTTCTTTTTCCTTCCTTCTTGGG - Intergenic
1002948295 6:1783611-1783633 TTAACCTTTCCTTGTTCCTTAGG + Intronic
1002999503 6:2318035-2318057 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1003033851 6:2625367-2625389 TTCCCTTTTCCTTCTGGCCTTGG - Intronic
1004262709 6:14122098-14122120 TTCCCTTTTCTCCCTTCCTTTGG - Intronic
1004268846 6:14175853-14175875 TTACCTTTTCCAGCTTCCAGAGG - Intergenic
1005080106 6:21948132-21948154 TTTCCTATTCCTACTTCCTGAGG - Intergenic
1005673353 6:28129350-28129372 TTACATGTTCTTTCTTCCATAGG + Intronic
1005717711 6:28567335-28567357 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1006265678 6:32920799-32920821 TTACTATTTCCTTCCTCCTTTGG - Intergenic
1006532052 6:34664045-34664067 TTGCCTTTTCCTGCTTCCAGAGG - Intronic
1006922981 6:37638446-37638468 AAACCTTGTCCTTCTTCCTGGGG - Intronic
1007047934 6:38796482-38796504 TTAGTTTTTACTTCTTTCTTTGG - Intronic
1007148624 6:39664234-39664256 TTACCTTCTATTTCTTCTTTGGG - Intronic
1007671975 6:43562991-43563013 ATACCTTTTCATTTCTCCTTGGG + Intronic
1008122420 6:47633730-47633752 TTGCCTTTTCCAGCTTCTTTAGG + Intergenic
1008302456 6:49857884-49857906 TTACCTTTTCCTGCTTCCAGAGG - Intronic
1008334899 6:50290873-50290895 TTCCCTTTTCCTACTTGCTAAGG - Intergenic
1008775279 6:55030960-55030982 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
1009023855 6:57974230-57974252 TTACTTTTTATTTCTTCCTGAGG + Intergenic
1009196574 6:60693846-60693868 TTGCCTTTTTTTTTTTCCTTTGG + Intergenic
1009199435 6:60725779-60725801 TTACTTTTTATTTCTTCCTGAGG + Intergenic
1009279677 6:61731970-61731992 TTAACTTCTCCTTCATCCTCAGG - Intronic
1009356603 6:62755609-62755631 TTACATTTTCATTCTGACTTAGG - Intergenic
1009493813 6:64325942-64325964 TTAGATTTCTCTTCTTCCTTAGG - Intronic
1009659476 6:66592307-66592329 TAACCGTATCCATCTTCCTTTGG - Intergenic
1009739058 6:67721081-67721103 TTACTTTTTCCTTTTTAATTTGG + Intergenic
1009935043 6:70224023-70224045 TTCCTTTTCCTTTCTTCCTTTGG - Intronic
1009979617 6:70711890-70711912 TTACCTTTTCCTTTCTGATTTGG + Intronic
1010349749 6:74859323-74859345 TTACCCTTTCCTTTTTATTTTGG - Intergenic
1010453837 6:76032188-76032210 TTTCCTTTTCTTTCTGGCTTGGG + Intronic
1010817427 6:80375255-80375277 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1010916625 6:81627215-81627237 TTACCATTTTCTTTCTCCTTGGG + Intronic
1011156501 6:84339746-84339768 TTAGATTTTTATTCTTCCTTGGG + Intergenic
1012295111 6:97512642-97512664 TTCCCTCTTTCTTCTTCATTTGG + Intergenic
1012299095 6:97562619-97562641 TTACATTTCTTTTCTTCCTTGGG + Intergenic
1013339207 6:109196704-109196726 TTACCATTACCTTCTGCCATAGG - Intergenic
1013946310 6:115727180-115727202 TTTAATTTTTCTTCTTCCTTGGG + Intergenic
1014161392 6:118173024-118173046 TTATCTTTTCCTTTCTCCTTTGG - Intronic
1014163102 6:118193054-118193076 TTATCTTTCCCTTCTTTTTTCGG + Intronic
1014214138 6:118736713-118736735 TTCCCTTTTCCTTCCAGCTTAGG - Intergenic
1014487678 6:122020329-122020351 TTAAATTTTCTTTCTTACTTTGG - Intergenic
1014546450 6:122741901-122741923 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1014547456 6:122749192-122749214 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1014566694 6:122957476-122957498 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1014639555 6:123892646-123892668 TTAGCTGCTCCTCCTTCCTTAGG + Intronic
1014721895 6:124927054-124927076 TTACCTTGTTCTTTTTACTTGGG + Intergenic
1014774499 6:125493186-125493208 TCACCTCTTGCTTCTGCCTTGGG - Intergenic
1015228058 6:130881236-130881258 TATCCTTTTCCTTCTTAATTAGG + Intronic
1015451926 6:133380062-133380084 TTGCCTTCTCCATCTTCCTTTGG + Intronic
1015709000 6:136119052-136119074 ATTCCATTTCCTTCTTCTTTGGG - Intronic
1015749710 6:136548338-136548360 TTACACCTTCCTTCTTTCTTTGG + Intronic
1015790518 6:136959978-136960000 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1015896344 6:138020629-138020651 TTGCCTTTTCCATCTTCCAGAGG + Intergenic
1016216187 6:141606869-141606891 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1016403968 6:143710383-143710405 TTAACTTTTTCTTATTCCTCTGG - Intronic
1016777532 6:147921322-147921344 TTACCTGTTTCTTCTTCTTCTGG - Intergenic
1016909994 6:149189392-149189414 TTGCGTTTATCTTCTTCCTTGGG + Intergenic
1017067011 6:150538569-150538591 TTTCCTTTTCCTTTTTTTTTTGG + Intergenic
1017159726 6:151353474-151353496 TCACCTTTTTCATCTTCTTTCGG - Exonic
1017326287 6:153144883-153144905 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
1017577852 6:155825492-155825514 TTGCATTTTCCCTCCTCCTTAGG - Intergenic
1017687561 6:156928446-156928468 AGACCTGTTCCTTCTCCCTTGGG - Intronic
1017843053 6:158237694-158237716 TCTCCCTTTCCTTGTTCCTTTGG + Intronic
1017899389 6:158706079-158706101 GTACCTTTTCATTCTGTCTTAGG + Intronic
1018165734 6:161093743-161093765 TTACCTTTCCCATTTTCTTTTGG + Intronic
1018244032 6:161804538-161804560 TTACCTTCTCCTTCTCCTTATGG - Intronic
1018315365 6:162551530-162551552 TTCCCTTTTCCTTTTTCTTTTGG + Intronic
1018413010 6:163574324-163574346 TTAACTTGACCTTTTTCCTTTGG + Exonic
1018637479 6:165876291-165876313 TTTTCTTTTCTTTCTTCATTTGG - Intronic
1018994955 6:168703557-168703579 TTTCCTTTTCCATTTTCCTTTGG + Intergenic
1019123265 6:169822412-169822434 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
1019812966 7:3178369-3178391 TTCCCTTTTCCTTCTGCCCAAGG - Intergenic
1020656968 7:10939965-10939987 TTCCCTTGTCCTTCTTGCGTCGG - Intronic
1020691844 7:11365144-11365166 ATTCCTTTTCGTTATTCCTTTGG + Intergenic
1020995574 7:15259443-15259465 TTAGATTTTTCTTCTTCCTTGGG - Intronic
1021202687 7:17743018-17743040 TTCCCTTTTCCCTCTCCCTAGGG - Intergenic
1021247843 7:18286238-18286260 TTACCTTTTCTTTTTTTCTTAGG - Intronic
1021505038 7:21373338-21373360 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1021705066 7:23359079-23359101 CAGCCTTTTCCTTCCTCCTTGGG + Intronic
1021734637 7:23631120-23631142 TTCCCTTTTTCTGCTTGCTTTGG - Intronic
1021849732 7:24795719-24795741 TTAGTTTTTACTTCTTCCTTTGG + Intergenic
1021893750 7:25214065-25214087 TTTCCTTATCTTTCTTCCTCAGG - Intergenic
1022247515 7:28574678-28574700 TTACCTTTTACTTCTTTGTAGGG + Intronic
1022886301 7:34649246-34649268 TTCCCCTTTCCTTCTTCCATTGG + Intergenic
1023215623 7:37859460-37859482 TTAGTTCTACCTTCTTCCTTTGG + Intronic
1023531392 7:41158929-41158951 TGACTTTTTCCCCCTTCCTTAGG - Intergenic
1023645284 7:42306277-42306299 TTAAGTTTTCCATCTTCCATGGG - Intergenic
1024204796 7:47148723-47148745 TTACATTTTTCTTCTTTGTTAGG + Intergenic
1024280919 7:47718899-47718921 TTACCTTCTCCTTCTCCCTCTGG - Intronic
1024327917 7:48126622-48126644 TTAAATTTTCCTTCTTCCTTGGG + Intergenic
1024718968 7:52113329-52113351 TTAGTTTTTACTTCTTCCTTTGG - Intergenic
1024802157 7:53092609-53092631 TTAGGTATTCCTTCTTCCATGGG + Intergenic
1025802853 7:64804125-64804147 TTAGTTTTTACTTCTTTCTTTGG - Intronic
1025940085 7:66069789-66069811 ATGCCTTTTCGTTCATCCTTGGG - Intergenic
1026768454 7:73175547-73175569 TGACCTTTTCCTTCATCTTCTGG + Intergenic
1027009324 7:74728918-74728940 TGACCTTTTCCTTCATCTTCTGG + Intronic
1027078719 7:75217110-75217132 TGACCTTTTCCTTCATCTTCTGG - Intergenic
1027497174 7:78902824-78902846 TTAGCTTTTCATACTTCCTAGGG - Intronic
1027563052 7:79756713-79756735 TTAGATTTTTCTTCTTCCATGGG + Intergenic
1027629503 7:80585048-80585070 TTTACTTTGCCTTGTTCCTTGGG - Intronic
1027853871 7:83484094-83484116 TTTCCTTTACCTTCTTGCTCTGG + Intronic
1027863411 7:83614883-83614905 TAATCTTTTAATTCTTCCTTGGG - Intronic
1027955515 7:84874521-84874543 TTCCATCTTCCTTCTTCTTTGGG + Intergenic
1028217166 7:88147843-88147865 TCACGTTTCTCTTCTTCCTTGGG - Intronic
1028469705 7:91192010-91192032 TTTCCTTTCCCTTCTTAATTGGG + Intronic
1028735364 7:94205404-94205426 TTCCATTCTCCTTCTGCCTTTGG - Intergenic
1029022455 7:97379083-97379105 TTCCATTTTCTTTTTTCCTTGGG - Intergenic
1029638726 7:101804388-101804410 TTTCCTTTTTTTTCTTCCTAAGG + Intergenic
1030093280 7:105876490-105876512 TTGCTTTTTCCCTGTTCCTTCGG + Exonic
1030430213 7:109436136-109436158 TTATTTTTTCCTACTTCTTTAGG + Intergenic
1030438035 7:109551137-109551159 TTGTCTCTTCCTTCTTCTTTGGG - Intergenic
1030456010 7:109774350-109774372 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1030804980 7:113905822-113905844 TTACCTTTTTCTTCTTGCCAGGG - Intronic
1031056147 7:116994916-116994938 TTACCGTTTCCTTCTTTCCTGGG + Intronic
1032153541 7:129450315-129450337 GTAGCCTTTCCTTCTTGCTTAGG + Intronic
1032209255 7:129897259-129897281 TTACCTTTTCCTTTTTCCTCTGG - Intronic
1032288799 7:130567347-130567369 TTAGATTTATCTTCTTCCTTGGG - Intronic
1032570328 7:132989304-132989326 TCACCTTTTCTATGTTCCTTTGG - Intronic
1032605137 7:133342627-133342649 TTAGATTTTTCTTCTTCCTCAGG + Intronic
1032719948 7:134542642-134542664 TTTCTTTGTCCTTCTTCCTTAGG + Intergenic
1032724847 7:134581058-134581080 TTTCTTTGTCCTTCTTCCTTAGG + Intergenic
1032772563 7:135073900-135073922 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1032922492 7:136565907-136565929 TTACATTTCTCTTCTTCCTCAGG + Intergenic
1033019264 7:137706292-137706314 TTTCCTTTTCCTTGTTCTCTAGG + Intronic
1033068168 7:138176106-138176128 TTTCCTTTTGATTCTTTCTTAGG - Intergenic
1033576815 7:142693421-142693443 TTACCTTTTCATTTGTCCTGAGG + Intergenic
1033670021 7:143482979-143483001 TTCCCTTTTCATTTTTGCTTTGG + Intergenic
1034058718 7:148066388-148066410 TTAGATTTCTCTTCTTCCTTGGG + Intronic
1034705359 7:153138420-153138442 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
1035034444 7:155885874-155885896 CATCCTTTTCCTTCTTCCTTTGG + Intergenic
1035393311 7:158519777-158519799 TTCCCTTTTTCTTCTTTCTGAGG - Intronic
1036193873 8:6697300-6697322 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1036531007 8:9587318-9587340 TTGCCTTTTCCATCTTCTTGGGG - Intronic
1036965126 8:13289071-13289093 TGACCTGTTCCTTTTTCCTAAGG + Intronic
1037461760 8:19117651-19117673 TTACCATTACGTTCTTCTTTTGG + Intergenic
1037673194 8:21032970-21032992 TGAGCTTTTTCTTTTTCCTTAGG + Intergenic
1038265014 8:26032359-26032381 TTCCCTATTGCTTCTTTCTTTGG - Intronic
1038895519 8:31777707-31777729 TTCCTTTTTCCTTCTGCCATGGG - Intronic
1039095416 8:33879772-33879794 TTACATTTCTCTTCTTCCTCAGG + Intergenic
1039166937 8:34692354-34692376 TTACCTTTTCCTCTTTTTTTTGG - Intergenic
1039596756 8:38797400-38797422 TTCCCATTGCTTTCTTCCTTTGG + Intronic
1039945285 8:42123525-42123547 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1040442687 8:47461251-47461273 TTAGATTTTTCTTCTTCCTCAGG + Intronic
1040689231 8:49913966-49913988 TTACCTTTGCCTAATCCCTTAGG + Intronic
1040986184 8:53296605-53296627 TTAGTTTTTACTTCTTTCTTTGG + Intergenic
1041082589 8:54227458-54227480 CTGCCTTTCCCTTCCTCCTTGGG - Intergenic
1041160638 8:55039566-55039588 TTATTTTTTTCTACTTCCTTTGG - Intergenic
1041233588 8:55776686-55776708 TTAGTTTTTACTTCTTTCTTTGG + Intronic
1041356599 8:57006922-57006944 TTATCTTTTCCTACTTCCACAGG + Intergenic
1041783493 8:61605006-61605028 TTATGCTTTCCTTCTACCTTGGG - Intronic
1041813311 8:61937179-61937201 TTATCATACCCTTCTTCCTTTGG + Intergenic
1042160714 8:65891476-65891498 TTAGATTTCTCTTCTTCCTTTGG - Intergenic
1042214976 8:66421968-66421990 TTTCCTTTGCTGTCTTCCTTTGG + Intergenic
1042327248 8:67541325-67541347 TTAGTTTTTACTTCTTTCTTTGG - Intronic
1042365041 8:67926201-67926223 TTCTCTCTTCCTTCTTCTTTTGG - Intergenic
1042545890 8:69950990-69951012 TGACACTTTCCTTCTTCATTTGG + Intergenic
1042593788 8:70424066-70424088 TTCTCTTTTCCTTTTTCTTTTGG + Intergenic
1042685034 8:71428887-71428909 TCACCTTTTCCATATTCCTAGGG + Intronic
1042841337 8:73126926-73126948 TTACCTTTTCCAGTTTCCATAGG + Intergenic
1042896975 8:73681004-73681026 TTAGATTTTTCTTCTTCCTCAGG - Intronic
1042995665 8:74694866-74694888 TTACATTTCTCTTCTTCCTCAGG - Intronic
1043023677 8:75039456-75039478 TTACCTTTTTTTTTTTCTTTGGG + Intergenic
1043045363 8:75316269-75316291 TTACTTTTTCTTTCTTTTTTTGG + Intergenic
1043048223 8:75353833-75353855 TTAGCTTTCTCTTCTTCCTCAGG - Intergenic
1043403764 8:79910032-79910054 TTTTCCTTTCCTTCCTCCTTTGG + Intergenic
1043421736 8:80105241-80105263 TTAGTTTTTACTTCTTTCTTTGG - Intronic
1044024950 8:87157411-87157433 TCACCTTATCCTTATTACTTTGG - Intronic
1044063009 8:87662794-87662816 TTACCTTTTCACTTTTCCTGAGG + Intergenic
1044141141 8:88654882-88654904 TTACATTTTCCTTCTTGCAGGGG - Intergenic
1044228503 8:89746895-89746917 TTTACTTTTTCTTCTTCCTCAGG - Intergenic
1044308424 8:90665351-90665373 TTCCATTTCCCTGCTTCCTTAGG + Intronic
1044549160 8:93493165-93493187 TTACCGTTCCCTTCTCCCATAGG + Intergenic
1044569940 8:93706167-93706189 TTGCTTGGTCCTTCTTCCTTTGG + Intronic
1044762388 8:95535263-95535285 TTTTCTTTTCCTTCTCCATTTGG + Intergenic
1044830138 8:96239294-96239316 TGACTTTTTCCTTCCTTCTTAGG - Intergenic
1044947753 8:97406972-97406994 TTACATTTCTCTTCTTTCTTGGG + Intergenic
1045263835 8:100602257-100602279 TTAGCTTTTCATTCTTCTCTGGG - Intronic
1045392973 8:101733512-101733534 TGACCTTTTCCCTATTCATTGGG - Intronic
1045722517 8:105130465-105130487 TTACCTTTTCTTTCCACCTTGGG - Intronic
1045859242 8:106796894-106796916 TCACCTTTGCCCTCTTCCATTGG - Intergenic
1047285711 8:123485615-123485637 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1047396222 8:124501486-124501508 TCACCTTTTCTTCTTTCCTTTGG - Intronic
1047592110 8:126337225-126337247 TTACTGGTTCCTTCTTACTTGGG - Intergenic
1047592143 8:126337728-126337750 TTAGATTTTTCTTCTTCCTCAGG - Intergenic
1047937333 8:129795695-129795717 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
1048144507 8:131827348-131827370 CCACCTTTTCCTACTGCCTTGGG - Intergenic
1048371541 8:133782688-133782710 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
1049066438 8:140320056-140320078 TTTCTTTTTCCTTCTTCCTTAGG - Intronic
1049477345 8:142802894-142802916 GTACCTTGCCCTTCTTCCATAGG - Intergenic
1050101279 9:2122747-2122769 TTACCTTTTCCTTCTTCCTTTGG - Intronic
1050633589 9:7586058-7586080 TTCGCTTTTCCTTGTTTCTTGGG + Intergenic
1050649845 9:7764253-7764275 TTACCTTTGCCTACCTGCTTAGG - Intergenic
1051601217 9:18876855-18876877 TTAGATTTATCTTCTTCCTTGGG + Intronic
1051733329 9:20170752-20170774 TTAGATTTTTCTTCTTCCTCAGG - Intergenic
1051762896 9:20488031-20488053 TTACCTTTTTATTGTGCCTTAGG + Intronic
1051976404 9:22955237-22955259 TTACCTTTTCTTTTCTACTTTGG - Intergenic
1052027819 9:23593596-23593618 TTAGCTTTGAGTTCTTCCTTTGG - Intergenic
1052243091 9:26298512-26298534 CTACCCTTTCCTTCTTCTTTGGG + Intergenic
1052571078 9:30225073-30225095 TTAATTTTTCTTCCTTCCTTGGG - Intergenic
1053211390 9:36231590-36231612 TTCTCTTTTCCTTCTTCCAAAGG + Intronic
1053566972 9:39263355-39263377 TTAATTTTACCTTTTTCCTTAGG - Intronic
1053832747 9:42101197-42101219 TTAATTTTACCTTTTTCCTTAGG - Intronic
1054130171 9:61355652-61355674 TTAATTTTACCTTTTTCCTTAGG + Intergenic
1054597806 9:67086213-67086235 TTAATTTTACCTTTTTCCTTAGG + Intergenic
1055125881 9:72717897-72717919 TTAGATTTCTCTTCTTCCTTAGG + Intronic
1055660828 9:78502457-78502479 CTCTCTCTTCCTTCTTCCTTGGG - Intergenic
1055794202 9:79956846-79956868 TTACCTTTTCCTTATTTTTCAGG + Intergenic
1056011434 9:82334835-82334857 TTTCCTCTTCCTTCAGCCTTTGG - Intergenic
1056111426 9:83399109-83399131 TTTCTTTGTCTTTCTTCCTTAGG - Intronic
1056266877 9:84906049-84906071 TTCCCATTTCCAGCTTCCTTTGG - Intronic
1057241405 9:93414262-93414284 TGACTTTTTGCTACTTCCTTGGG + Intergenic
1057375247 9:94515336-94515358 TTTCCTTATCTTTCTTCCTTTGG - Intergenic
1057475849 9:95400532-95400554 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1058079678 9:100688827-100688849 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1058337773 9:103854134-103854156 TTGCCTCCTCCTTTTTCCTTAGG - Intergenic
1058759389 9:108116166-108116188 TTTTCTTTTCCTTTTTCCTTGGG + Intergenic
1059018136 9:110544061-110544083 TTAATTTTTCCTGCTTCCTCTGG - Intronic
1059149644 9:111937895-111937917 TTACTATTTCTTTCTTCTTTGGG - Intergenic
1059827593 9:118049197-118049219 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1059861664 9:118470333-118470355 TTTTCCTGTCCTTCTTCCTTAGG - Intergenic
1059903142 9:118951567-118951589 TTGCCTTTTCCTCCTTCATCAGG - Intergenic
1060314324 9:122495290-122495312 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1060623480 9:125089350-125089372 TAACCTTTTCCTGCTTTTTTGGG - Intronic
1061111242 9:128572846-128572868 TTGCCTTTTCCCCCTTGCTTTGG + Intronic
1061561098 9:131403937-131403959 ATACTTTTTTTTTCTTCCTTAGG + Intronic
1061654392 9:132077802-132077824 TTACCTTTTTTTTCCTCCTTTGG - Intronic
1203750892 Un_GL000218v1:79186-79208 TTTCTTTTTCTTTCTTCCTTGGG - Intergenic
1203483095 Un_GL000224v1:25159-25181 TTTCTTTTTCCTTCTTCCTGGGG + Intergenic
1203366767 Un_KI270442v1:265408-265430 TTCCCTTTACCTTCTTCTTGTGG - Intergenic
1203541486 Un_KI270743v1:92272-92294 TTTTTTTTTCCTTCTTCCTGGGG + Intergenic
1185910410 X:3975776-3975798 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1185928882 X:4179079-4179101 TTATTTTTTTCTTCTTCCTGTGG + Intergenic
1186822301 X:13303148-13303170 TTTCCTTTTGATTCTTTCTTAGG + Intergenic
1187101017 X:16191992-16192014 TTCCTTTTTCCTTTTGCCTTGGG + Intergenic
1187109148 X:16278227-16278249 TTAGATTTCTCTTCTTCCTTAGG + Intergenic
1187588992 X:20694606-20694628 TTAGATTTCTCTTCTTCCTTAGG - Intergenic
1187986213 X:24814363-24814385 TTTCCTTTTTCTTTTTCCTTTGG + Intronic
1188043656 X:25400291-25400313 TTTCCTTTTCCTTTCTCCATGGG + Intergenic
1188104294 X:26130686-26130708 TTAACTTTTTTTTCTTTCTTAGG + Intergenic
1188180012 X:27043842-27043864 TTTCCTTTTGTTTCTTTCTTAGG + Intergenic
1188495882 X:30782547-30782569 TTACCTTTTCTATATTCTTTTGG - Intergenic
1188694640 X:33175482-33175504 ATTCCTTTTCCTCCTTCCCTAGG - Intronic
1189009313 X:37030493-37030515 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1190124047 X:47687592-47687614 CTGCCTTTTCCTTCTTCCCTAGG - Intergenic
1190951370 X:55147128-55147150 TTGCCATTACCTTCTTCTTTTGG - Intronic
1190990945 X:55549604-55549626 TTTCCTTTTCCTTTTTTCATAGG - Intergenic
1191914473 X:66186829-66186851 TTAGAATTCCCTTCTTCCTTAGG + Intronic
1192060018 X:67814317-67814339 TTTGCTTTTTCTTCTCCCTTGGG - Intergenic
1192231510 X:69268319-69268341 ATTCATTTTCCTTCTTCTTTGGG - Intergenic
1192993838 X:76491466-76491488 TTAGATTTTTCTTCTTCCTTGGG + Intergenic
1193556712 X:82962280-82962302 TTTCTTTTTCCTTCTTATTTTGG - Intergenic
1193590751 X:83385846-83385868 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1193646625 X:84078145-84078167 TTACCTTTCCCTTTTTCACTGGG - Intronic
1193730788 X:85100231-85100253 TTACCTTTTCCTTTCTACTATGG - Intronic
1193771674 X:85594649-85594671 TTAGATTTTTCTTCTTCCTCAGG - Intergenic
1193932515 X:87572297-87572319 CTACCCTTTCTTCCTTCCTTAGG + Intronic
1194144182 X:90243285-90243307 TTAGCTTTCCCTTCTCCCTTAGG - Intergenic
1194537997 X:95131412-95131434 CTAGCTTTTTCTTCTTGCTTAGG - Intergenic
1194967486 X:100304959-100304981 TTAGATTTCTCTTCTTCCTTGGG - Intronic
1194998903 X:100622975-100622997 TTACATTTTCCATGTTCTTTGGG + Intergenic
1195096119 X:101502734-101502756 TTATTTTTTTCTTCTTCTTTAGG + Intronic
1195158278 X:102144253-102144275 TTAGATTTTCCCTCTTCCTTGGG + Intergenic
1195236255 X:102901658-102901680 TTTAATTTTCCTTCTTCCTGGGG - Intergenic
1195237267 X:102912712-102912734 TTAGATTTCTCTTCTTCCTTAGG - Intergenic
1195818172 X:108911081-108911103 TTAGATTTCTCTTCTTCCTTGGG - Intergenic
1195954209 X:110311695-110311717 TTACACTGTACTTCTTCCTTTGG + Intronic
1195985039 X:110620642-110620664 TTAGATTTATCTTCTTCCTTGGG + Intergenic
1196161457 X:112488523-112488545 TTAGATTTCCCTTCTTCCTCAGG - Intergenic
1196794926 X:119494640-119494662 TCCCTTTTTCTTTCTTCCTTAGG - Intergenic
1196831095 X:119776194-119776216 TTCCCATGCCCTTCTTCCTTTGG + Intergenic
1197289341 X:124636620-124636642 CTAACTTTTCCTTCTTCCTTTGG + Intronic
1197476180 X:126928546-126928568 TTAGATTTTTCTTCTTCCTCAGG + Intergenic
1197560858 X:128019406-128019428 TTACTTTTTCTTTCTTCATATGG - Intergenic
1197572032 X:128162078-128162100 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1197601503 X:128536633-128536655 TTTCCTTTACCTCCTTGCTTAGG + Intergenic
1197919133 X:131571735-131571757 TTTCCTTTTATTTCTTCTTTTGG + Intergenic
1198437451 X:136630907-136630929 TTTCCTTTTCCTTTTCACTTGGG - Intergenic
1198589218 X:138157876-138157898 TTATCTTTTCCTCCTTCCATAGG - Intergenic
1198604409 X:138321355-138321377 TTAGATTTCTCTTCTTCCTTGGG + Intergenic
1198697306 X:139355360-139355382 AGACCTTTTCCTTCTGCTTTAGG - Intergenic
1198745929 X:139890582-139890604 TTTCAGTTTACTTCTTCCTTGGG - Intronic
1198885530 X:141332163-141332185 TTAACTTTAGTTTCTTCCTTTGG - Intergenic
1198975842 X:142334204-142334226 TTTCCCTTTCTTTCTTCCCTAGG - Intergenic
1199014826 X:142803330-142803352 TTAAATTTCTCTTCTTCCTTGGG + Intergenic
1199206077 X:145149642-145149664 TTACATTTCTCTTCTTCCTCAGG - Intergenic
1199355892 X:146863405-146863427 TTTTCTTTTTTTTCTTCCTTTGG - Intergenic
1199645139 X:149901857-149901879 TAAGCTTTTCTTTTTTCCTTGGG + Intergenic
1199926849 X:152476122-152476144 GTACCTTCTCCTTGTTTCTTGGG - Intergenic
1200489947 Y:3812593-3812615 TTAGCTTTCCCTTCTCCCTTAGG - Intergenic
1201071917 Y:10154821-10154843 TTACCTTTACCTTCTTCTTGTGG + Intergenic
1201164548 Y:11196810-11196832 TTTCTTTTTCCTTCTTCCTGAGG - Intergenic
1201556662 Y:15270125-15270147 TTAGTTTTTACTTCTTTCTTTGG - Intergenic
1201951003 Y:19564009-19564031 ATACCTTTCCATTTTTCCTTAGG - Intergenic