ID: 1050101280

View in Genome Browser
Species Human (GRCh38)
Location 9:2122764-2122786
Sequence AGGTAAATAACAATGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050101279_1050101280 -6 Left 1050101279 9:2122747-2122769 CCAAAGGAAGAAGGAAAAGGTAA 0: 1
1: 0
2: 10
3: 126
4: 989
Right 1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG No data
1050101275_1050101280 14 Left 1050101275 9:2122727-2122749 CCAATTTCAGTATGGTAGAACCA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG No data
1050101274_1050101280 15 Left 1050101274 9:2122726-2122748 CCCAATTTCAGTATGGTAGAACC 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1050101280 9:2122764-2122786 AGGTAAATAACAATGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050101280 Original CRISPR AGGTAAATAACAATGATTGA TGG Intronic
No off target data available for this crispr