ID: 1050105746

View in Genome Browser
Species Human (GRCh38)
Location 9:2164624-2164646
Sequence CATGGAAATCAGCATCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050105746_1050105749 14 Left 1050105746 9:2164624-2164646 CCTTGCTGATGCTGATTTCCATG 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1050105749 9:2164661-2164683 AACAGAAAATGCCGTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050105746 Original CRISPR CATGGAAATCAGCATCAGCA AGG (reversed) Intronic
900631867 1:3640747-3640769 CAAGCATCTCAGCATCAGCAGGG + Intronic
901107135 1:6765258-6765280 CATTGACATCAGCATCACCCAGG + Intergenic
903694779 1:25198691-25198713 CAGGGAAATAAGTATCAGTAGGG + Intergenic
906506660 1:46384846-46384868 CCAGGACATCAGCATCAGCCTGG - Intergenic
907711270 1:56884247-56884269 CATGGAAATCAGCATGTGCGAGG + Intronic
912530585 1:110318248-110318270 CATGGAAAGGAGCATGAGCTTGG - Intergenic
916449948 1:164911174-164911196 CATGGAGAATAGCAGCAGCATGG + Intergenic
917707072 1:177645575-177645597 CATGGAATCCAGCTGCAGCAGGG + Intergenic
917913832 1:179679973-179679995 CATGGAATGCAGCAAAAGCAGGG - Intronic
918433442 1:184486227-184486249 TATTGAAATGAGCATCAGCATGG - Intronic
918515648 1:185359596-185359618 CATAGAATTCAGAATCTGCATGG + Intergenic
919132400 1:193467973-193467995 CATGGAAATCAACCCAAGCATGG + Intergenic
919574241 1:199287036-199287058 TATGGAAAACAGCAGCAGCCTGG + Intergenic
922483901 1:225958461-225958483 GATGGAAATCCACATTAGCATGG - Intergenic
923800543 1:237204955-237204977 CAGGGTAATGAGCCTCAGCAGGG + Intronic
924580734 1:245321851-245321873 CATAGAAAGCAGCATCACCTTGG + Intronic
924781407 1:247151752-247151774 CATGCATATGTGCATCAGCACGG + Intronic
1068515158 10:58016863-58016885 CATTTGAATCAGCATCAGCTGGG - Intergenic
1069160437 10:65085025-65085047 CAAGGACATCAGCTGCAGCAGGG - Intergenic
1069261349 10:66402326-66402348 CAAGGAAATCACAGTCAGCAGGG - Intronic
1069525009 10:69161953-69161975 CATGCAACTCAGCAGCGGCAAGG + Intronic
1069666827 10:70168156-70168178 CATACAAATCAGCAGCAGCCGGG - Intronic
1070467132 10:76734706-76734728 CATGTACATCATCATCAGTAAGG + Intergenic
1073755809 10:106579413-106579435 CACTGAGAGCAGCATCAGCATGG + Exonic
1074749507 10:116570786-116570808 CAAGAAAATGAGCATAAGCAAGG + Intergenic
1074788576 10:116863820-116863842 CATGGAAACCAGCTCCAGCCTGG - Intronic
1075507721 10:123039741-123039763 CATTGAAATCAGCATAAGGTGGG + Intronic
1075603111 10:123785321-123785343 CATGGAAATCATCATAAGGGCGG - Intronic
1076544518 10:131236359-131236381 CATGGAAATCAGCCTCAGACAGG + Intronic
1077119395 11:899842-899864 CAGGGAAGGCAGCATCAGCCAGG - Intronic
1080379230 11:31750279-31750301 AATGGAAATCAGCCTCAGTGTGG + Intronic
1082629847 11:55529103-55529125 CAAGGACAACAGCATGAGCAAGG - Intergenic
1083512205 11:63220345-63220367 CATGGAATTCAGCCTCAGCAAGG - Intronic
1083643736 11:64159954-64159976 CATGGAAATGAGCGTCAGCCTGG + Intronic
1086523236 11:87696474-87696496 CATAGAAATCAGAATCTGGATGG - Intergenic
1087819252 11:102692944-102692966 ACTGGAAAGCAGCATCAACACGG + Exonic
1088619950 11:111671600-111671622 CATGGACAGCATCATCACCAAGG - Intronic
1089402232 11:118171011-118171033 CAGGGAAATCAACATCTGCCTGG + Intronic
1089435439 11:118461525-118461547 CAAGGACATCAGTGTCAGCAAGG + Intronic
1089769877 11:120795203-120795225 CATGGAAATCTTCAGCAGCGAGG + Intronic
1089943869 11:122447073-122447095 CATGCAAATAAGGATCACCAGGG + Intergenic
1090142398 11:124278332-124278354 CATGGAATTCAGAATCTGGATGG + Intergenic
1090669123 11:128933889-128933911 CATGGCAGTCATCATCAGCTGGG - Intergenic
1091967916 12:4761150-4761172 CATGGAATTGAACAGCAGCACGG + Intronic
1092936323 12:13367357-13367379 CAGGGTAATGAGCCTCAGCAGGG - Intergenic
1094464932 12:30743017-30743039 CAAGAAAAGCAGCATCAGCTGGG + Intronic
1101574322 12:105983451-105983473 CATGGAGAACAGCAAGAGCAAGG + Intergenic
1103330292 12:120149544-120149566 TATGAAAACCAGCCTCAGCAAGG - Intronic
1103694906 12:122807157-122807179 CCAGGAATTCAGGATCAGCATGG + Intronic
1109301214 13:60592072-60592094 CCTGGAAAACAGCATTTGCAAGG - Intergenic
1112600985 13:100855688-100855710 CATGAAAACCAGGATCATCATGG + Intergenic
1113289547 13:108889737-108889759 CATGATCATCAGCATAAGCAAGG - Intronic
1113351577 13:109534670-109534692 GATGCAAATCAGCAAAAGCAAGG + Intergenic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114665960 14:24377358-24377380 CAGGGGAATCGGTATCAGCAGGG - Exonic
1114938440 14:27574126-27574148 CATGGAATTCAGAATCTGGATGG + Intergenic
1116707308 14:48318571-48318593 CATGGGCATCAGCATCTACAAGG - Intergenic
1117601944 14:57385259-57385281 GAAGGAAATCAGCATTAGGATGG + Intergenic
1118850942 14:69582985-69583007 AAAGGAAATCAGACTCAGCAAGG - Intergenic
1124551417 15:30684303-30684325 CATTTGAAGCAGCATCAGCATGG + Intronic
1124679831 15:31721362-31721384 CATTTGAAGCAGCATCAGCATGG - Intronic
1126890856 15:53202798-53202820 GAAGGAAATCAGCATCTGCTGGG - Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129937142 15:79460212-79460234 CATGGGAATCACCATCCCCAAGG - Intronic
1130515368 15:84622164-84622186 CCTGGAAATGAGGATGAGCAAGG - Exonic
1131559525 15:93427355-93427377 CATGGGACTCAGACTCAGCAGGG - Intergenic
1132160294 15:99535235-99535257 GCTGGAAATCAGCCTGAGCAGGG - Intergenic
1135127968 16:19827241-19827263 CATGGAACTCAGCTTGTGCATGG + Intronic
1137563017 16:49515134-49515156 CTTGCAAATGAGCATCAGGATGG - Intronic
1138282655 16:55783877-55783899 CATGGAAATCTGCTCCAGGAGGG + Intergenic
1138456992 16:57126778-57126800 GGTGGAAGTCATCATCAGCATGG + Intronic
1139581066 16:67873799-67873821 CCTGGAAATCAGTTTCAGAACGG - Intronic
1140577423 16:76187191-76187213 CATGGAATCCAGCATCTGGATGG + Intergenic
1141392341 16:83675331-83675353 AATGGAAATAAACATTAGCATGG + Intronic
1143828205 17:9630080-9630102 CTTTGAAATGAGCATCAGCAGGG - Intronic
1149981179 17:61312656-61312678 CATGGAAACCAGCATCCCGAGGG - Intronic
1152185359 17:78852895-78852917 AATGGGAATCAGCCTCTGCAAGG - Intergenic
1152422873 17:80203583-80203605 CAAGTAAATCAGCATCTCCAGGG + Intronic
1152671858 17:81612980-81613002 CACGGGAATCAGCATCTCCAGGG + Intronic
1152967921 18:133380-133402 CAAGAAAATCAGCATAAACAAGG + Intergenic
1153925432 18:9831563-9831585 CAGGGTAATGAGCCTCAGCAGGG + Intronic
1154004246 18:10513161-10513183 TAAGGAAATCAGCCTCAGCCAGG - Intergenic
1154383595 18:13873617-13873639 CCTGGAAGGCAGCATGAGCAAGG - Intergenic
1155068024 18:22285432-22285454 CATGGAAGTGAGAAACAGCAGGG + Intergenic
1155652468 18:28158512-28158534 CATGGAATGAAGCATCAGGAAGG - Intronic
1155705537 18:28806060-28806082 CATGGAGATGTGCATGAGCAAGG + Intergenic
1156177361 18:34562670-34562692 CATCCACATCAGCATCACCAGGG + Intronic
1156426592 18:37020006-37020028 CGTGGAGATCTGCCTCAGCACGG + Intronic
1158021382 18:52846244-52846266 CAAGGAATTCAGCTTCAGCCAGG + Intronic
1159403990 18:67976581-67976603 CATTGAATTCAGAATCAGGATGG - Intergenic
1163784267 19:19266595-19266617 CATGTACATCAGCATCTGCAGGG + Exonic
925039459 2:719904-719926 GATCAAAGTCAGCATCAGCATGG - Intergenic
925246075 2:2384311-2384333 CAGGGAAAGGAGCATCAGCAGGG - Intergenic
926188915 2:10712631-10712653 CATGGAGATCAGAGTGAGCAGGG + Intergenic
926287268 2:11499289-11499311 CCTGGGAAACAGCAACAGCAAGG + Intergenic
928217584 2:29375124-29375146 CATGAGAAACAGCAGCAGCAAGG + Intronic
929456306 2:42068558-42068580 ATTGGAAAACTGCATCAGCATGG + Intergenic
932105962 2:68943361-68943383 CATGGAATTCAGAATCTGAATGG - Intergenic
932113003 2:69018365-69018387 CCTGCAAATCAGCACCAGCAGGG - Intronic
932125921 2:69145523-69145545 CATGGAAAGAAACATCAGGAGGG + Intronic
934756511 2:96828207-96828229 CCTGGCCCTCAGCATCAGCAGGG - Intronic
935848112 2:107188183-107188205 CATGCTCATCAGCAGCAGCAGGG - Intergenic
937040359 2:118815990-118816012 CATGGAAATGAGCTTGACCAAGG - Intergenic
938032500 2:128007413-128007435 CTTGGATTTCAGCATCTGCAGGG + Intronic
939085085 2:137708687-137708709 CAAGGACATCAGCTGCAGCAGGG - Intergenic
939902324 2:147865662-147865684 GAGGGAGATCAGAATCAGCAAGG - Intronic
940099036 2:150012301-150012323 CATGAAAACAAGCTTCAGCAAGG - Intergenic
940219780 2:151340126-151340148 CATACCAATCAGCATCAGAATGG - Intergenic
941510679 2:166405255-166405277 GATAGAGATCAGCAGCAGCAGGG - Exonic
942343212 2:174972151-174972173 CAAGGAAACCAGTAGCAGCAAGG - Intronic
943257769 2:185618371-185618393 CATAGAAATCAGAATCTGAATGG - Intergenic
948308423 2:236967521-236967543 CATTGAGATGAGCATCAGCCAGG - Intergenic
1169879356 20:10329460-10329482 CATGGGAATCTGCATTACCAGGG - Intergenic
1170784101 20:19452700-19452722 GATTGAAAACAGCTTCAGCAAGG + Intronic
1171198030 20:23216512-23216534 CATCAGCATCAGCATCAGCAGGG + Intergenic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1172941090 20:38655253-38655275 GGTGGAAATGAGCCTCAGCAGGG + Intergenic
1173331918 20:42082404-42082426 CATGGATGCAAGCATCAGCAAGG - Intronic
1173853209 20:46232043-46232065 CCTGGACACCAGCATCAGGAGGG + Intronic
1174315274 20:49694982-49695004 CATAGAAGTGAGCATCAGCAGGG - Intronic
1175061784 20:56249826-56249848 CATGGAAATGATCATCAGTCGGG + Intergenic
1177655475 21:24011246-24011268 CATGGCAGTCACCATCAGTAGGG + Intergenic
1178141829 21:29693026-29693048 CCTGGAAATCAGCATAAACATGG + Intronic
1178396706 21:32249482-32249504 CATGGATTCCAGCCTCAGCAGGG + Intergenic
1181370474 22:22411050-22411072 GATGCAATTCAGCAACAGCAGGG - Intergenic
1182721000 22:32400050-32400072 CATGGAATTCAGGATCAGAGAGG - Intronic
1183278702 22:36919817-36919839 CATCTAAATCAGCATCCTCAGGG - Intronic
1184725488 22:46342605-46342627 CCTGGAGTTCAGTATCAGCATGG + Intronic
1185092544 22:48784152-48784174 CCTGGAACTCTGCATCTGCAAGG + Intronic
950336049 3:12194063-12194085 CATGGAACTCATCATCATCTTGG + Intergenic
951201171 3:19876445-19876467 GATGGGAATCAGCAGCAGGATGG + Intergenic
951450573 3:22833222-22833244 CAGGGAAATCAGAAACAGCATGG + Intergenic
953475362 3:43201450-43201472 CTAGGAAATCAGCAGCAGAATGG - Intergenic
953660230 3:44886567-44886589 CACTGAAGTCAGCAACAGCACGG - Intronic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
956022563 3:64948157-64948179 CATGGTGATCAGTATCATCAGGG + Intergenic
957254912 3:77824813-77824835 CATGGAATTCAGAATCTGGATGG - Intergenic
958031324 3:88114546-88114568 TATGGAAATTAGAATCAGCCAGG - Intronic
958540993 3:95471992-95472014 CATGGATTTCAGTAACAGCATGG + Intergenic
958827767 3:99052547-99052569 CATGGAAATAATTATAAGCAAGG - Intergenic
959494308 3:107031278-107031300 CATGGAATTCAGAATCTGGATGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
962961937 3:140319319-140319341 CAGGGAACTCACCCTCAGCATGG - Intronic
963724092 3:148899828-148899850 CATACAAAGCAGCAGCAGCAAGG + Intergenic
963822261 3:149910261-149910283 AAAGAAAATCAGCAGCAGCAGGG - Intronic
964898753 3:161630964-161630986 CATGGACAGCAGCATCAACATGG - Intergenic
965340543 3:167485436-167485458 CATAGAATTCAGCATCTGGATGG + Intronic
966841001 3:184087436-184087458 CATGGAGTTCAGAATCAGCCTGG - Intergenic
966988516 3:185204441-185204463 CGTGGAAAACAGCATCAGCGCGG - Exonic
967161413 3:186741873-186741895 CATGGACATAAGCATAAGCATGG + Exonic
970290173 4:14563409-14563431 CATGGAAACCAGGATCATCTGGG + Intergenic
971958362 4:33453389-33453411 CCTGGAAATCTGCCTGAGCATGG - Intergenic
972363584 4:38351610-38351632 CATAGAATTCAGAATCTGCATGG + Intergenic
972447803 4:39162844-39162866 CAGCAAAATCAGCATCAGCCAGG + Intergenic
974234428 4:59162299-59162321 CATAGTAATCAGATTCAGCAAGG + Intergenic
974914294 4:68160937-68160959 CATAGAATTCAGAATCAGGATGG - Intergenic
975745742 4:77472644-77472666 CCTGGAAATATGCCTCAGCAAGG - Intergenic
975829971 4:78359031-78359053 CATAAAAATCACCCTCAGCATGG - Intronic
976584330 4:86778371-86778393 CATAGCAAGCAGCATGAGCATGG + Intronic
976850146 4:89535777-89535799 CATAGAATTCAGAATCAGGATGG - Intergenic
980261750 4:130458334-130458356 AATGGAAAGCAGCAAAAGCAGGG - Intergenic
981300293 4:143179078-143179100 CATGTAAATGATCATCAGAACGG - Intergenic
985958931 5:3284829-3284851 CATGGCATTCAGCAACAGGAAGG + Intergenic
986284649 5:6350504-6350526 CAAGGACAGCAGCAGCAGCAAGG - Intergenic
986327889 5:6691833-6691855 AATGGAAATCAGAAATAGCATGG - Intergenic
986587226 5:9330957-9330979 CATGAAAATCAGCATTACCTGGG + Intronic
987510721 5:18834449-18834471 CATGGAAATATGGATGAGCATGG - Intergenic
988369986 5:30356226-30356248 CCTGCAAATCGGAATCAGCATGG - Intergenic
989000488 5:36755372-36755394 CATAGAAATCAACAAGAGCAAGG + Intergenic
990634605 5:57710465-57710487 CATGGAAGTCAGATTCATCATGG + Intergenic
990729780 5:58795703-58795725 AATGGAAATCACCATTAGAAGGG - Intronic
990872555 5:60448672-60448694 CAGGGAAGCCAGCATCAGAATGG + Intronic
991534101 5:67647592-67647614 GAGGGAAATCAGCACCAGCTTGG + Intergenic
994691120 5:103020770-103020792 AATGAAAAGCAGCAACAGCAAGG + Intronic
994942006 5:106336019-106336041 CATGGAAATCAACAGGAGAAAGG + Intergenic
997306454 5:132840562-132840584 CATGTAACTCAGCATCATGATGG - Intergenic
998682717 5:144487956-144487978 CATGGTAATAAGAATAAGCAAGG - Intergenic
999879885 5:155850590-155850612 CATGGAATTCACCATCTGCTAGG + Intergenic
1001667104 5:173442466-173442488 CATGGGAAGCAGCATCACAAGGG - Intergenic
1002212520 5:177607335-177607357 CCTGGAGAGCAGCAACAGCACGG + Exonic
1004223107 6:13763901-13763923 CTTGGAAATTAGCTTCTGCAGGG - Intergenic
1004591335 6:17054686-17054708 CATGGAAATGACCATCATGAAGG + Intergenic
1006329751 6:33381948-33381970 CCAGGAATTCAGCATCAGCCTGG - Intergenic
1006779358 6:36621651-36621673 CATCCAGATCAGCATCAGGAAGG + Intergenic
1007002441 6:38327015-38327037 CATGGAAAACAACTTCACCAAGG + Intronic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1008049620 6:46886812-46886834 CATGGACCTCAGGACCAGCAGGG - Intronic
1009682345 6:66912902-66912924 TATGGAACTCAGCAACTGCAAGG + Intergenic
1011030617 6:82918967-82918989 CATGGAGATGAGCATTACCAGGG - Intronic
1012383680 6:98652059-98652081 AATGGAAATGAGGATGAGCAAGG + Intergenic
1013142062 6:107347133-107347155 CATGGAAATGAGGACCTGCATGG + Intronic
1013581787 6:111542326-111542348 CATAGAAATCATCATCATCGGGG - Intergenic
1013824764 6:114197965-114197987 CATGGAATTCAGAATCTGGATGG + Intronic
1014587465 6:123217341-123217363 CATTGTAATTACCATCAGCAAGG - Intronic
1015093915 6:129391413-129391435 CATGGTATTCAGCATCTGCTGGG - Intronic
1016663641 6:146610311-146610333 CATAGAATTCAGCATCTGGATGG - Intronic
1018145072 6:160878047-160878069 CATGGAATTCAGAATCTGGACGG + Intergenic
1018836546 6:167488574-167488596 CATGGACTTCAGCATCAGGCAGG + Intergenic
1021642183 7:22748981-22749003 CATGTGACTCAGCAACAGCAGGG + Intergenic
1023127727 7:36972478-36972500 GCTGGAAGTCTGCATCAGCAGGG + Intronic
1024117930 7:46210485-46210507 CTTGGAAAGCAGCAACTGCATGG - Intergenic
1024238888 7:47418622-47418644 CATGGAAAACATCATCTCCAGGG - Intronic
1024923826 7:54591291-54591313 AATGGAAATAAGCAGCACCATGG + Intergenic
1028077178 7:86531450-86531472 AATGGAAAACAGAATAAGCAGGG - Intergenic
1028196263 7:87911455-87911477 CCTGTTAATTAGCATCAGCATGG - Intergenic
1029350240 7:100008260-100008282 CATGTAAATCAGCAGTTGCAGGG - Intergenic
1032117149 7:129126934-129126956 CAGGGAGATCAGCATCTGCATGG + Intergenic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1035646064 8:1222051-1222073 CATGGAATTCAGAATCTGGATGG - Intergenic
1037564738 8:20108251-20108273 CCAGGAAAACAGAATCAGCAAGG - Intergenic
1041298372 8:56385939-56385961 CACGGCAATTAGCAGCAGCAGGG + Intergenic
1043113487 8:76217832-76217854 CAAGGAAATCAGCATAGGCAAGG - Intergenic
1045879530 8:107021346-107021368 CATAGAATTCAGCATCTGGATGG + Intergenic
1046735752 8:117775192-117775214 AATGGAAATCAGAAAAAGCAAGG + Intergenic
1047783039 8:128125383-128125405 CATGCAAATTAGCATCATCCTGG - Intergenic
1048244631 8:132779966-132779988 AATGGAAATAAGCATTAGCCAGG + Intronic
1048382838 8:133883325-133883347 CAAGGAATGCTGCATCAGCAAGG - Intergenic
1050105746 9:2164624-2164646 CATGGAAATCAGCATCAGCAAGG - Intronic
1051000184 9:12272710-12272732 CATTAAAATAAGAATCAGCAAGG + Intergenic
1051202363 9:14641724-14641746 TATGGAAGTGAGCATCAGGAGGG - Intronic
1051512599 9:17895311-17895333 CATGGGCATCAGAATCACCAGGG - Intergenic
1052635579 9:31099526-31099548 CATTGAAAACATCATCACCAGGG + Intergenic
1053511676 9:38693198-38693220 CATGGGAATGAACATCAGGAAGG - Intergenic
1056429777 9:86515648-86515670 CATGGAAAACAGTTTCAGAACGG + Intergenic
1057599101 9:96441633-96441655 TGTGGAAATCAGCAGCAGCCTGG - Intergenic
1185808332 X:3080791-3080813 CATTGAAATCCTCATCTGCAAGG - Intronic
1187509991 X:19909031-19909053 GATGGAAATTAACATCACCAAGG - Intergenic
1187614904 X:20982120-20982142 CATGTGCATCAGCAGCAGCAGGG - Intergenic
1188517625 X:31004505-31004527 CATTGAAAACATCATCAGAATGG + Intergenic
1188548975 X:31341008-31341030 CTTGGAAATCATCTTCAGAAAGG + Intronic
1189236272 X:39489606-39489628 CATGGAAGTGGGCCTCAGCATGG + Intergenic
1191147211 X:57179441-57179463 AATGGAAATCAGAAAAAGCAGGG + Intergenic
1191614021 X:63148413-63148435 CATGGTAATCAGGTTCACCAAGG + Intergenic
1191622275 X:63230514-63230536 CATGGTAATCAGGTTCACCAAGG - Intergenic
1193291310 X:79776596-79776618 CATAGAATTCAGAATCAGTATGG - Intergenic
1195206049 X:102601130-102601152 CAACTAAATCAGCAGCAGCAGGG - Exonic
1195867788 X:109451952-109451974 CCTGGAAATCAGTATTAACAAGG + Intronic
1198277661 X:135111952-135111974 CATGGAATTCAGTATCTGGATGG - Intergenic
1198767878 X:140096631-140096653 CATCACAATCAGCATCAGGATGG - Intergenic
1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG + Intergenic