ID: 1050105877

View in Genome Browser
Species Human (GRCh38)
Location 9:2166248-2166270
Sequence CATGGCGCCCAGAACTCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050105872_1050105877 3 Left 1050105872 9:2166222-2166244 CCAGTCTCCTAGTGTCCCATTTA 0: 1
1: 1
2: 2
3: 14
4: 140
Right 1050105877 9:2166248-2166270 CATGGCGCCCAGAACTCCAATGG No data
1050105871_1050105877 10 Left 1050105871 9:2166215-2166237 CCACATTCCAGTCTCCTAGTGTC 0: 1
1: 0
2: 0
3: 23
4: 174
Right 1050105877 9:2166248-2166270 CATGGCGCCCAGAACTCCAATGG No data
1050105873_1050105877 -4 Left 1050105873 9:2166229-2166251 CCTAGTGTCCCATTTAAAACATG 0: 1
1: 0
2: 0
3: 24
4: 305
Right 1050105877 9:2166248-2166270 CATGGCGCCCAGAACTCCAATGG No data
1050105870_1050105877 22 Left 1050105870 9:2166203-2166225 CCTAGACATTGGCCACATTCCAG 0: 1
1: 0
2: 0
3: 19
4: 163
Right 1050105877 9:2166248-2166270 CATGGCGCCCAGAACTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050105877 Original CRISPR CATGGCGCCCAGAACTCCAA TGG Intronic
No off target data available for this crispr