ID: 1050105907

View in Genome Browser
Species Human (GRCh38)
Location 9:2166534-2166556
Sequence AGTAAGGCTGGAACTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050105907 Original CRISPR AGTAAGGCTGGAACTACACA GGG (reversed) Intronic
900532031 1:3159166-3159188 AGGGAGGCTGGAGGTACACAGGG + Intronic
900597458 1:3488824-3488846 AGTCAGCCTGGAAATGCACAAGG - Intergenic
904620785 1:31773760-31773782 AGTAAAGGAGGAACTACAGATGG + Intergenic
905731532 1:40302308-40302330 AGGCAGGCTGGAGCCACACACGG - Intronic
911643226 1:100311291-100311313 AGGAAACCTGGAACTACACAAGG + Intergenic
912269682 1:108196459-108196481 AGTAAGGCTCAAACTTGACAAGG + Intronic
912924856 1:113905043-113905065 ATTAAGGCTGGAACTGGAGAGGG - Intronic
914948101 1:152084990-152085012 AGAGAGGCTGGTACTACAAAGGG - Exonic
919180411 1:194073652-194073674 TGTAAGGCTGGCACTACATTAGG + Intergenic
919894918 1:202003575-202003597 AGGGAGGCTGGCACTCCACAAGG + Intronic
919894935 1:202003644-202003666 AGGGAGGCTGGCACTCCACAAGG + Intronic
920159454 1:203985072-203985094 AGTAGGGTTGGAAATACACATGG - Intergenic
920720915 1:208386076-208386098 ACTCAGACTGGACCTACACATGG + Intergenic
921159739 1:212464429-212464451 AGGAAGGCAGGTGCTACACATGG - Intergenic
921773958 1:219075345-219075367 AGTTAGGCTGGGATGACACATGG - Intergenic
922085626 1:222344279-222344301 AGCAAGGCGGGAACTAGACCAGG + Intergenic
922085724 1:222345002-222345024 AGTAAGGTAGGAACTAGACCAGG - Intergenic
923464444 1:234235710-234235732 AGAAAGCCTGGAACTACAAAAGG - Intronic
1064005681 10:11697077-11697099 AGTAAGGCTGGGAGTACAGTAGG - Intergenic
1067163979 10:43850415-43850437 AATAAATCTGGACCTACACATGG - Intergenic
1067941904 10:50663646-50663668 ATTAAGGCTGGATCTACAAGAGG - Intergenic
1068335580 10:55629610-55629632 GGTTAGGCTGGAACTAAACAAGG - Intergenic
1068560233 10:58506273-58506295 AGAAATGCTTGAATTACACATGG + Intergenic
1070863147 10:79688597-79688619 ATTAAGGCTGGATCTACAAGAGG - Intergenic
1072733973 10:97866925-97866947 GGTCAGGCTGGACCCACACAGGG - Exonic
1075444270 10:122502991-122503013 AGTAAGCCTAGAAGTAAACAGGG - Intronic
1076199152 10:128544563-128544585 AGAAAGGCTGGCTCTACACTTGG - Intergenic
1079027289 11:16959691-16959713 AGAAAGGCTGGAGCAACAAAAGG + Intronic
1079453339 11:20616653-20616675 ACCAAGGCTGGAACTAAACTTGG - Intronic
1081320975 11:41691144-41691166 AGAAAGGTTCGAACTAGACAGGG - Intergenic
1089131687 11:116217348-116217370 AGAAAGGTTGATACTACACAAGG + Intergenic
1090488711 11:127138764-127138786 AGTAAGGCTGGAGATAAACTGGG - Intergenic
1091068519 11:132541204-132541226 AGGAAGGCCGGAAATACTCAGGG - Intronic
1091114637 11:133001650-133001672 AGGAAGGCTGGTACTCCAGATGG - Intronic
1095929823 12:47614224-47614246 AGTAAGTCTAAAACTCCACAGGG + Intergenic
1105252016 13:18707706-18707728 ACTAAGGGTGGAAAAACACATGG - Intergenic
1106185637 13:27407315-27407337 AGTAAGTTTTGAACTACACAGGG - Intergenic
1115955486 14:38774433-38774455 ATAAAGGGTGGAACTTCACATGG + Intergenic
1118822243 14:69353103-69353125 AATGAGGCTGGGACTACTCAGGG - Intronic
1120072418 14:80118534-80118556 ATTTAGGTTGGAACTACAAAGGG - Intergenic
1120717285 14:87853418-87853440 ACAAAGGCTGGGACTACAGAGGG + Intronic
1121380474 14:93461602-93461624 AGTAAGGATGAAAGTAGACAAGG - Intronic
1122038902 14:98968230-98968252 AGGAAGGCTGTATCTTCACATGG - Intergenic
1129183218 15:73889937-73889959 AGAAAGGCTGAAACTGCAGAAGG + Intergenic
1129708875 15:77810056-77810078 AGTAAGCCTGGCACTAATCAGGG + Intronic
1134337214 16:13311598-13311620 ATTAAGGCAGCAACTACAGAGGG + Intergenic
1142933867 17:3311035-3311057 AGTGAGGTGGGAACTACACGTGG - Intergenic
1142995829 17:3759767-3759789 AGTATGGAGGGCACTACACAGGG - Intronic
1143913753 17:10273887-10273909 AGCATGGCTGGAATTTCACAAGG - Intergenic
1146042673 17:29471995-29472017 AGGAAAACTGGAATTACACATGG - Intronic
1151144210 17:72024907-72024929 AATAAGGCTGGAAATAGGCAAGG - Intergenic
1155154889 18:23149846-23149868 AGTAAAGCTGGAGGTACACAAGG - Intronic
1155706725 18:28824559-28824581 TGTAAGGCTGGAACAACTGAGGG - Intergenic
1164009981 19:21193205-21193227 AGTTAGGGTGGAACTCCACCTGG - Exonic
1166434481 19:42755707-42755729 AGTAATGATGGGACTACCCATGG + Intronic
924964566 2:63468-63490 TCTAAGGGTGGAAATACACAGGG + Intergenic
925710260 2:6732127-6732149 AGAAATGCTGGAACCTCACATGG - Intergenic
925714925 2:6775253-6775275 TGAACGGCTGGAACTGCACATGG - Intergenic
928070590 2:28211361-28211383 AATAAGGAAGGAACTATACATGG - Intronic
931768692 2:65479172-65479194 AGGAAGGCTGGAACGCCACTTGG + Intergenic
947370554 2:229441081-229441103 AGTAAGGCTGAAAATGCTCATGG - Intronic
948530530 2:238600745-238600767 AGTAAGCCAGGAACCACACAGGG - Intergenic
1168875108 20:1166056-1166078 AGTTAGGCAAGAACCACACAAGG - Exonic
1169836026 20:9880094-9880116 AGAAGAGCTGGAACCACACAGGG - Intergenic
1170695781 20:18657273-18657295 AGTAATGCATGAACTACAAAAGG - Intronic
1176837545 21:13807558-13807580 ACTAAGGGTGGAAAAACACATGG - Intergenic
1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184445752 22:44545852-44545874 AGTAAGGGTGGAACTAGAAGGGG + Intergenic
953098753 3:39805673-39805695 AATAAGGCAGGAAGTACAGATGG - Intergenic
954572812 3:51656251-51656273 AGTAAGGCCAGAAATACAAAAGG - Intronic
955320633 3:57972014-57972036 AGTAAAGCTGGAACGACCCAGGG + Intergenic
957742684 3:84292416-84292438 AATCTGGCTGGAAGTACACAGGG + Intergenic
960706862 3:120490439-120490461 AGTAAGACAGGGACTACAAAAGG + Intergenic
964498082 3:157316730-157316752 ATCAAGGCTAGAACTACATAAGG + Intronic
967866652 3:194195483-194195505 AGAAAGGCTGGGACTGCCCAAGG - Intergenic
967894158 3:194383399-194383421 AGTAAGGTTGCAACAACCCAGGG - Intergenic
971419536 4:26462823-26462845 AGGAAGGCTCAAACTACTCAAGG - Intergenic
971974175 4:33662103-33662125 AGGAAAGCTGGAATTACAAATGG - Intergenic
974688564 4:65265930-65265952 AGTCAGGCTTGAATTACAGATGG + Intergenic
974883420 4:67786878-67786900 ACTCAGGCTGGAACTACACCAGG - Intergenic
975774837 4:77774797-77774819 AGAGAGGCTGCAAATACACATGG + Intronic
975811257 4:78172115-78172137 AGTGAGGCAGGAAACACACAGGG - Intronic
976823976 4:89238422-89238444 AGAAAGGCTGGAGCTATATAGGG + Exonic
979173924 4:117637844-117637866 AGTAAGTCTAAAACTTCACAGGG - Intergenic
980437788 4:132801610-132801632 AGTAAAGTAGGACCTACACATGG - Intergenic
982872299 4:160596484-160596506 AGTAAGGTTGCCACTATACAGGG + Intergenic
983293775 4:165839718-165839740 ACTAAATCTGGAAGTACACAAGG + Intergenic
985299953 4:188477912-188477934 AGTAAGTCCAGAACTACACCTGG + Intergenic
985508179 5:296751-296773 AGTAAGACTGGCATTGCACATGG + Intronic
985739859 5:1608920-1608942 AGTAAGACTGGCATTGCACATGG - Intergenic
987651610 5:20748595-20748617 AGTAATGCTGGCATAACACATGG - Intergenic
991003546 5:61806294-61806316 AGTAAGGAAGGAAGTACAGACGG + Intergenic
993346004 5:86783409-86783431 AGGAAGGCTGGATCCTCACAGGG + Intergenic
993748295 5:91630253-91630275 AGCAAGGCTGGATCCTCACATGG - Intergenic
994725196 5:103427184-103427206 AGAAAGTCTGAAACTACACTTGG + Intergenic
995883883 5:116871262-116871284 AGTAAGTCTGGAACCCAACAGGG - Intergenic
996096093 5:119400678-119400700 AGTACAGGAGGAACTACACAAGG + Intergenic
996295645 5:121912412-121912434 AGGAAGGCTGGAACTCCAGGTGG + Intergenic
1005317674 6:24619904-24619926 AGTCAGGCTGGAACTATATTTGG - Intronic
1006531924 6:34662936-34662958 AGCCAGGCTGGGACTACACAGGG + Intronic
1010047938 6:71469518-71469540 AGTAAGGCTGAAGGTTCACAGGG - Intergenic
1013499667 6:110735993-110736015 AGTAAGGCTGGCACTGCTGAGGG - Intronic
1016363614 6:143292972-143292994 AGGAAGACGGGAACTAAACAAGG - Intronic
1017086765 6:150719911-150719933 AATCAGGCTGAACCTACACATGG - Intronic
1020917186 7:14209430-14209452 AGTAGGACAGCAACTACACAAGG + Intronic
1021230726 7:18084104-18084126 AGTGAGCCTTGAACAACACAGGG - Intergenic
1022827622 7:34032259-34032281 AGGAAAGCTGGAAGTACATATGG - Intronic
1024936360 7:54716021-54716043 ATTAAGCCTGGAACTAGACCTGG - Intergenic
1026256496 7:68716543-68716565 AGTAAGGGTGGAAGTAGACAGGG + Intergenic
1029846003 7:103412946-103412968 TGCAAGGTTGGAAATACACAAGG + Intronic
1034964712 7:155384003-155384025 GGCTAGGCTGGAACTACACCTGG - Intronic
1039053838 8:33518218-33518240 ACTAGGGCAGGAATTACACAAGG + Intergenic
1039859534 8:41445049-41445071 AGTATGGCTGGAGCTAGACTGGG + Intergenic
1050105907 9:2166534-2166556 AGTAAGGCTGGAACTACACAGGG - Intronic
1050155505 9:2662744-2662766 AGGAAGGCTGGAAGAAAACAAGG + Intergenic
1051215145 9:14789607-14789629 AGTAAGGCTGGAAACATACTGGG - Intronic
1052847384 9:33349281-33349303 AGTAATGCGGGAAATACAGAGGG + Intronic
1054901308 9:70372093-70372115 TGTAAGTCTGGAACTGCAAATGG - Intergenic
1056518461 9:87377229-87377251 AGTGATGCTGCAATTACACATGG - Intergenic
1058996859 9:110307614-110307636 AGTCAAGCTGGAACTACTTAGGG + Intronic
1189852504 X:45191576-45191598 GGTAAGACAGGAACTAAACAAGG - Intronic
1195105514 X:101599168-101599190 AGGAGGGATAGAACTACACAGGG - Intergenic
1195107368 X:101614599-101614621 AGGAGGGATAGAACTACACAGGG + Intergenic