ID: 1050106775

View in Genome Browser
Species Human (GRCh38)
Location 9:2174044-2174066
Sequence CTGCTGTACGTGGGCATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050106775 Original CRISPR CTGCTGTACGTGGGCATAAC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
903280986 1:22249823-22249845 CTGCTGTACATGTGAATGACTGG + Intergenic
905785742 1:40755932-40755954 CAGCTGTAGTTGGGGATAACTGG + Intronic
906528793 1:46511607-46511629 CTGCTGCACGTGGGAATCTCTGG - Intronic
917011727 1:170481793-170481815 CTGCTGTACCTGGACAGAGCAGG - Intergenic
918253394 1:182724926-182724948 CTGTTGTAAGTGGACATATCTGG + Intergenic
922330339 1:224569503-224569525 CTCCTGTACGTGTGCACAAAGGG - Intronic
1064384419 10:14878360-14878382 CGGCTGCACGTGGGCATGGCTGG - Intergenic
1070969163 10:80549419-80549441 CTGCTGTATGGAGGCAGAACAGG - Intronic
1075598737 10:123751488-123751510 CTCCTATACGTGGGCAGAAGGGG + Intronic
1077059112 11:609986-610008 CTCCTGCAGGTGGGCAGAACAGG + Intronic
1081569095 11:44278584-44278606 CAGCTGGAGGTGGGCAAAACTGG - Intronic
1097791327 12:63818295-63818317 ATGTAGTACGTGGGTATAACTGG - Intergenic
1109274705 13:60290705-60290727 CTGCTGAACCTGGGCCCAACAGG - Intergenic
1109435785 13:62299804-62299826 CTGTTCTATGTGGGCATAAAGGG - Intergenic
1121315496 14:92958854-92958876 CTGGTGTACGTGCTCAGAACAGG - Intronic
1129624986 15:77187743-77187765 CTGCTGTACGTGGGCTTTTAAGG + Intronic
1131055412 15:89371787-89371809 CTGCTGTGGGTGCGCATACCCGG - Intergenic
1146706698 17:35005477-35005499 CTGATGAACGTGGGCATCAGAGG + Exonic
1151273032 17:73011591-73011613 CTGCTATACGACAGCATAACAGG + Intronic
1151309543 17:73285073-73285095 TGGCTGTACGTGGCCAGAACTGG + Exonic
1153924082 18:9817739-9817761 ATGCTGTACCTGTGCATAAAAGG - Intronic
1157198377 18:45638692-45638714 ATGGTGTACCTGGGCATAAAGGG + Intronic
1160067283 18:75587453-75587475 CTGGTGAACTTGGGCACAACTGG - Intergenic
1163361639 19:16850679-16850701 CTGCAGGACGTGGGCAGAGCTGG - Intronic
1163523596 19:17806988-17807010 ATGCTGTAAGTGGGAATAGCTGG + Intronic
1166165739 19:40987095-40987117 CTGCTGAATGGGGGCATAATAGG + Intergenic
932196763 2:69790588-69790610 CTGCTGTAAGTGGGTATATGGGG + Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
941086589 2:161125364-161125386 CTGCTGAATGTTGACATAACAGG + Intergenic
948834705 2:240620408-240620430 CTGCTGCAGGTGGGCAGAGCTGG + Intronic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1185353986 22:50355198-50355220 TTGCTGTATGTGGATATAACAGG - Intronic
949797071 3:7863023-7863045 ATGCTGTACCGGGGCAGAACAGG + Intergenic
950912209 3:16605987-16606009 CTGCTGTACCTGGTAATCACAGG - Intronic
956678156 3:71754131-71754153 CTGCTGTGCGTGAGCCTAGCGGG + Exonic
961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG + Intronic
966248891 3:177839627-177839649 GTGCTGTGCCTGGGTATAACAGG + Intergenic
966644400 3:182227221-182227243 CTTCAGTACGTGGGAAGAACAGG + Intergenic
968678574 4:1899771-1899793 CTTCTGCACGTGGGCCTCACTGG + Intronic
970465924 4:16323047-16323069 CTTCTATTCGTGGGCATAATGGG + Intergenic
984203352 4:176755285-176755307 CTGCTGTAAGTGGGCAGCATGGG - Intronic
988808574 5:34763259-34763281 CAGCTGTACGTGAGAAGAACTGG - Intronic
1001475463 5:172047528-172047550 CTGATGAGCGTGGGCCTAACAGG + Intronic
1001906435 5:175477590-175477612 CTGCTGTGAGTTGGCATCACAGG - Intronic
1004325413 6:14670106-14670128 CTGCTGTACATTGGGACAACTGG + Intergenic
1009708095 6:67281366-67281388 CAGCTTTACGTGTGCATGACTGG - Intergenic
1020543593 7:9493730-9493752 CTGCTGGTCATGGGCAGAACAGG - Intergenic
1022841303 7:34166512-34166534 CAGCTGTACTTGGGCATCAGGGG + Intergenic
1023223341 7:37943844-37943866 CTTCTGTATGTGGGCAGAGCGGG + Intronic
1050106775 9:2174044-2174066 CTGCTGTACGTGGGCATAACTGG - Intronic
1050684099 9:8147629-8147651 CTGCTATACCTGGACAGAACAGG + Intergenic
1051500808 9:17775829-17775851 CTGATGCACTTGGGCAGAACAGG - Intronic
1060982071 9:127798722-127798744 CTGCTATATGTGGGTATAAAAGG + Intronic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1185641747 X:1592349-1592371 CTGCGGTAGGTGGGAATACCAGG + Intronic
1191033176 X:55997213-55997235 CTGTTGGACCTGGACATAACAGG - Intergenic
1192919730 X:75694198-75694220 CTGCTGCACCTGGACATAGCAGG + Intergenic