ID: 1050110665

View in Genome Browser
Species Human (GRCh38)
Location 9:2212032-2212054
Sequence TACCTAGTCCAGTAACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050110664_1050110665 -6 Left 1050110664 9:2212015-2212037 CCACTGTATATTCATAATACCTA No data
Right 1050110665 9:2212032-2212054 TACCTAGTCCAGTAACAGACTGG No data
1050110663_1050110665 12 Left 1050110663 9:2211997-2212019 CCACTTCTTTCTTATTCACCACT No data
Right 1050110665 9:2212032-2212054 TACCTAGTCCAGTAACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050110665 Original CRISPR TACCTAGTCCAGTAACAGAC TGG Intergenic
No off target data available for this crispr