ID: 1050110839

View in Genome Browser
Species Human (GRCh38)
Location 9:2214129-2214151
Sequence GTGAGAAACAGGACTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050110836_1050110839 7 Left 1050110836 9:2214099-2214121 CCAGGGACAGGGAGAAACAGGAC No data
Right 1050110839 9:2214129-2214151 GTGAGAAACAGGACTGAGATAGG No data
1050110831_1050110839 23 Left 1050110831 9:2214083-2214105 CCATGGCCAACAGGGTCCAGGGA No data
Right 1050110839 9:2214129-2214151 GTGAGAAACAGGACTGAGATAGG No data
1050110834_1050110839 17 Left 1050110834 9:2214089-2214111 CCAACAGGGTCCAGGGACAGGGA No data
Right 1050110839 9:2214129-2214151 GTGAGAAACAGGACTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050110839 Original CRISPR GTGAGAAACAGGACTGAGAT AGG Intergenic
No off target data available for this crispr