ID: 1050111971

View in Genome Browser
Species Human (GRCh38)
Location 9:2226663-2226685
Sequence GCTTCTATAGCCCCAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050111971_1050111972 17 Left 1050111971 9:2226663-2226685 CCAGGTGCTGGGGCTATAGAAGC No data
Right 1050111972 9:2226703-2226725 TCACTGCCCCCACCCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050111971 Original CRISPR GCTTCTATAGCCCCAGCACC TGG (reversed) Intergenic
No off target data available for this crispr