ID: 1050115436

View in Genome Browser
Species Human (GRCh38)
Location 9:2258703-2258725
Sequence TGGTCTTTGGATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050115423_1050115436 26 Left 1050115423 9:2258654-2258676 CCGCCCACCCGATAACTATTTGT No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115430_1050115436 -4 Left 1050115430 9:2258684-2258706 CCCTAGCCATGGAGACTTCTGGT No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115424_1050115436 23 Left 1050115424 9:2258657-2258679 CCCACCCGATAACTATTTGTATC No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115427_1050115436 18 Left 1050115427 9:2258662-2258684 CCGATAACTATTTGTATCTACTC No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115431_1050115436 -5 Left 1050115431 9:2258685-2258707 CCTAGCCATGGAGACTTCTGGTC No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115422_1050115436 29 Left 1050115422 9:2258651-2258673 CCACCGCCCACCCGATAACTATT No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115425_1050115436 22 Left 1050115425 9:2258658-2258680 CCACCCGATAACTATTTGTATCT No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115421_1050115436 30 Left 1050115421 9:2258650-2258672 CCCACCGCCCACCCGATAACTAT No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115426_1050115436 19 Left 1050115426 9:2258661-2258683 CCCGATAACTATTTGTATCTACT No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data
1050115432_1050115436 -10 Left 1050115432 9:2258690-2258712 CCATGGAGACTTCTGGTCTTTGG No data
Right 1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050115436 Original CRISPR TGGTCTTTGGATAAGGAGGA AGG Intergenic
No off target data available for this crispr