ID: 1050116053

View in Genome Browser
Species Human (GRCh38)
Location 9:2264561-2264583
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 12, 1: 72, 2: 148, 3: 164, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050116053_1050116061 23 Left 1050116053 9:2264561-2264583 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG No data
1050116053_1050116059 3 Left 1050116053 9:2264561-2264583 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1050116059 9:2264587-2264609 CAGCAGTGGGTCTGCGACGGAGG No data
1050116053_1050116057 -10 Left 1050116053 9:2264561-2264583 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1050116057 9:2264574-2264596 GAGGGGTGGAAGTCAGCAGTGGG No data
1050116053_1050116060 19 Left 1050116053 9:2264561-2264583 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1050116060 9:2264603-2264625 ACGGAGGCAATCAGCAGCAGTGG No data
1050116053_1050116058 0 Left 1050116053 9:2264561-2264583 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1050116058 9:2264584-2264606 AGTCAGCAGTGGGTCTGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050116053 Original CRISPR TCCACCCCTCCGGATCCGGC AGG (reversed) Intergenic
904397182 1:30229837-30229859 TCCACCCCTCCGGATCCGGCAGG + Intergenic
906507521 1:46391139-46391161 TCCATCCCTCTGGATCCGGCAGG - Intergenic
906582995 1:46952051-46952073 TCCATCCCTCCAGATCCAGCAGG + Intergenic
907340686 1:53733859-53733881 TTCTCCCCTCCGGCTCCGGTGGG - Intronic
907506067 1:54919099-54919121 TCTATCCCTCTGAATCCGGCAGG - Intergenic
907602959 1:55788500-55788522 TCCACCCCTCTGGATACGGCAGG - Intergenic
908523395 1:64966130-64966152 TCCAGCCCCGCGGAGCCGGCGGG - Intronic
908717668 1:67087563-67087585 TCCACCCCTCCAGATCTGGCAGG + Intergenic
908723219 1:67148182-67148204 TCCACCCCTCTGGATCCGGCAGG - Intronic
908852959 1:68392349-68392371 TTCACCCCTCTAGATCCGGCAGG - Intergenic
908892688 1:68863891-68863913 TCCACCCCTCTGGATCCGGCTGG + Intergenic
910116674 1:83739164-83739186 TCCATCCCTCTGGATCCGGCAGG - Intergenic
911158119 1:94656296-94656318 TCCACCCCTCTGAATGGGGCAGG - Intergenic
912285713 1:108366246-108366268 TCCATCCCTCCGGATCCAGCAGG - Intergenic
912463397 1:109852550-109852572 TCCGCCCCTCTGGATCCGGCAGG - Intergenic
912862846 1:113230103-113230125 TCCACCCCTCAGGAGCCTGGAGG + Intergenic
913470776 1:119183084-119183106 TCCAACCCTCTGGATCTGGCAGG - Intergenic
917097525 1:171414029-171414051 TCCACCCCTTGGGATCTGGCAGG - Intergenic
917403526 1:174678885-174678907 TCCATCCCTCCGGATAGGGCAGG - Intronic
917413371 1:174783114-174783136 TCCAGCCCTCTGGATCCTGCAGG + Intronic
917438527 1:175045264-175045286 TCCACCCCGTCGGAGCTGGCAGG - Intergenic
920639845 1:207741472-207741494 TCCATTCCTCCGGATCCGGCAGG - Intergenic
922007931 1:221551009-221551031 TCCATCCCTCCAGATCAGGCAGG - Intergenic
922683925 1:227624831-227624853 TCCATCCCTCTGGATCTGGCAGG - Intronic
922685152 1:227633116-227633138 TCCACCCCTCCGGATCCGGCAGG - Intronic
922876312 1:228942558-228942580 TCCATGCCTCCAGATCAGGCAGG + Intergenic
922877776 1:228953936-228953958 TCCATCCCTCTGGATCTGGCAGG + Intergenic
923036256 1:230287124-230287146 TCCAGCCCTCATGAGCCGGCGGG - Intergenic
924002308 1:239567893-239567915 TCCACCTCTCTGGTTCCTGCTGG + Intronic
924560882 1:245155838-245155860 TCCAACTCTCCGGATCCTGCAGG - Intronic
924626436 1:245699772-245699794 TCCAGCCCTCAGCCTCCGGCAGG + Intronic
1063113953 10:3060158-3060180 TCCTCCCCTCCAGACCCTGCTGG - Intergenic
1065199853 10:23301966-23301988 TCCATCCCTCTGGATCCAGCAGG - Intronic
1065222791 10:23513331-23513353 TTCACCACTCCGGATCCGGCAGG - Intergenic
1065557535 10:26931532-26931554 GCCAGCCCTCGGGAACCGGCAGG - Intergenic
1066246831 10:33591918-33591940 TCCATCCCTCTGGATCCAGCAGG - Intergenic
1066673009 10:37859411-37859433 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1068191620 10:53659798-53659820 TCCATCCCTCCGGATCCGGCAGG + Intergenic
1068791289 10:61034006-61034028 TCCACCCCTCCGGATCTGGCAGG - Intergenic
1068792064 10:61039471-61039493 TCCACCCCTCCGGATATGGCAGG - Intergenic
1068988842 10:63130969-63130991 TCCACCCCTCTGGATCCATCAGG - Intergenic
1069037959 10:63664954-63664976 TCCACCCCTCTGGATCCCGCAGG - Intergenic
1069633514 10:69911910-69911932 TGCACCCCTCCGGCTCCTGTAGG + Intronic
1071051880 10:81460207-81460229 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1071082697 10:81831266-81831288 TCCGCCCCTCTGGATCTGGCAGG - Intergenic
1071326719 10:84525688-84525710 TCCACCCCTCCGGATCTGGCAGG - Intergenic
1071327408 10:84530628-84530650 TCCACCCCTCTGGATCTGGCAGG - Intergenic
1071334600 10:84590347-84590369 CCCACCCCTCCGGGTCAGCCTGG - Intergenic
1071557001 10:86612127-86612149 TCCATCCCTCCGGTTCCGGCAGG + Intergenic
1072151568 10:92689310-92689332 TCCAGCCATCCGAATCCCGCCGG + Intergenic
1072378556 10:94841346-94841368 TCCATCCCTCCAGATCTGGCAGG - Intronic
1072472431 10:95724683-95724705 TCCACCCCTCTGGATCCAGCAGG - Intronic
1072650319 10:97290283-97290305 CCCATCCCTCCGGATCTGGCAGG + Intronic
1072795088 10:98348596-98348618 TCAATCCCTCCAGATCCCGCAGG + Intergenic
1074978459 10:118599843-118599865 TCCACCCCTCTGGATGCAGCAGG - Intergenic
1076424304 10:130356639-130356661 TTGGACCCTCCGGATCCGGCAGG + Intergenic
1078191867 11:9097734-9097756 TCCACCCCTCCAGATCCGGCAGG + Intronic
1079601737 11:22317895-22317917 TCCATCCCTCCGGATGCGGCAGG - Intergenic
1079692848 11:23441425-23441447 TCCATCCCTCCAGATCCGCAAGG + Intergenic
1079761857 11:24338973-24338995 TCCACACCTCTGGATTCTGCAGG + Intergenic
1079884279 11:25966515-25966537 TCCATCCCTCAGGATCCAGCAGG - Intergenic
1079933250 11:26590769-26590791 TCCACCCCTCCGGATCCAGCAGG - Intronic
1079934235 11:26597488-26597510 TCAACCCCTCCAGATCCGGCAGG - Intronic
1080881478 11:36325315-36325337 TCCAACCCTCCAGATCCAGCAGG - Intronic
1081063039 11:38504042-38504064 TCCACCCCTCTGGATCCAGCAGG + Intergenic
1081069733 11:38595819-38595841 TCCATCCCTCTGGATCCAGCAGG - Intergenic
1081070183 11:38602018-38602040 TCCACCCCTTTGGATCCAGCAGG + Intergenic
1081070866 11:38606891-38606913 TCCACCACTTTGGATCCAGCAGG + Intergenic
1082737611 11:56873946-56873968 TCCACCCCTCCAGATCCGGCAGG + Intergenic
1083107008 11:60368086-60368108 TCTACCCCTCCGGATCTGGCAGG + Intronic
1083202079 11:61126748-61126770 TCCACCCCTGCGGATCCCTCTGG + Exonic
1084444705 11:69196859-69196881 ACCACTCCTCCTGCTCCGGCCGG - Intergenic
1084878731 11:72154346-72154368 TCCACCCCTCCAGATCTGGCAGG + Intergenic
1085601985 11:77863296-77863318 TCCATCCCTCCGGATCCGGCAGG - Intronic
1085621576 11:78041731-78041753 CCCATCCCTCCGGATCTGGCAGG + Intronic
1085721132 11:78913356-78913378 CCCACCCCTCCGGCTGCAGCTGG - Intronic
1085900971 11:80699524-80699546 TCCACCCCTCCGGATCCGGCAGG - Intergenic
1086511203 11:87559875-87559897 TCCACCCCTCCAGATCCGGCAGG - Intergenic
1087901295 11:103644846-103644868 TCCACCCCTCCAGATCCGGCAGG - Intergenic
1088110102 11:106251181-106251203 TCTATCCCTCTGGATCTGGCAGG + Intergenic
1088484617 11:110328700-110328722 TCCACCACTCTGGATCAGGCAGG - Intergenic
1088879807 11:113964532-113964554 TCCATCCTTCTGGATCCAGCAGG + Intergenic
1091207817 11:133833170-133833192 TGCCCCGCTCCGGTTCCGGCTGG + Intergenic
1092293648 12:7181312-7181334 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1092469918 12:8768281-8768303 TCCACCCCTCCAGATCCAGCAGG - Intronic
1093106656 12:15095415-15095437 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1094375233 12:29783073-29783095 GCCACCCCTCCGGAACCCTCTGG + Intronic
1094641004 12:32275704-32275726 CCCATCCCTCCAGATCCGGCAGG + Intronic
1095138582 12:38636666-38636688 CCCACCCCTCCGGATCTGGCAGG + Intergenic
1095283470 12:40384053-40384075 CCTACCCCTCCGGATCTGGCAGG + Intergenic
1095284202 12:40389213-40389235 TCCACCCCTCCAGATTTGGCAGG + Intergenic
1095552477 12:43459212-43459234 TCCATCCCTCCGGATCCAACAGG + Intronic
1095893106 12:47253016-47253038 TCCATCCCTCCAGATCAGGCAGG - Intergenic
1096351228 12:50902815-50902837 TCCATTCCTCTGGGTCCGGCAGG - Intergenic
1096352545 12:50912186-50912208 TCCATCCCTCTGGATCTGGCAGG - Intergenic
1096939398 12:55325702-55325724 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1097376740 12:58852182-58852204 TCCATCCCTCCAGATCCAGCAGG - Intergenic
1097377748 12:58859311-58859333 TCCATCCCTCCAGATCCAGCAGG - Intergenic
1097840852 12:64320004-64320026 TCCATCCCTCCGGATCCGGCAGG + Intronic
1098639873 12:72825591-72825613 TCCATCCCTCCCAATCCAGCAGG - Intergenic
1098984879 12:77001494-77001516 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1099292621 12:80790119-80790141 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1099605039 12:84794137-84794159 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1100205060 12:92339661-92339683 TCCATGCCTCTGGATCTGGCAGG - Intergenic
1101555290 12:105803002-105803024 TCCACCCCTCTAGATCCGACAGG - Intergenic
1102612236 12:114122393-114122415 TCCACCCCTCCCAATCATGCAGG - Intergenic
1103802561 12:123548839-123548861 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1103804003 12:123558424-123558446 TCTAGCCGTCCGGATCCGGCAGG + Intergenic
1103872335 12:124100796-124100818 TCCACCCCTCCGGATCCGGCAGG - Intronic
1103873173 12:124105971-124105993 TCCACCCCTCCGGATCCAGCAGG - Intronic
1104187862 12:126449628-126449650 TCCATCCCTCCAGATCCAGCAGG - Intergenic
1104850961 12:131873518-131873540 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1104851962 12:131880510-131880532 TCCACCTGTCCAGGTCCGGCAGG - Intergenic
1107119187 13:36778821-36778843 TCCACTCCTCCTGATGGGGCAGG + Intergenic
1107156422 13:37172361-37172383 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1107700916 13:43046823-43046845 TACACCCCTCTGGATCCAGCAGG + Intronic
1108876208 13:55054067-55054089 CCCATCCCTCCAGATCCGGCAGG + Intergenic
1108877228 13:55061382-55061404 CCCATCCCTCCAGATCTGGCAGG + Intergenic
1109292826 13:60497121-60497143 TCCACCCTTCCGGATCCAGCAGG - Intronic
1109520624 13:63505540-63505562 TCCATCCCTCTGGATCCGGCGGG - Intergenic
1109523582 13:63545100-63545122 TCCATCCCTCCAGATCCAGCAGG - Intergenic
1109594006 13:64525867-64525889 TCCATCCCTCCAGATCCAGTAGG + Intergenic
1109931303 13:69222057-69222079 CCCATCCCTCCGGATCCGGCAGG + Intergenic
1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG + Intergenic
1110846149 13:80192474-80192496 TCCATCCCTCCGGATCTGGCAGG + Intergenic
1110987071 13:81984398-81984420 TCCATCCCTCCAGATCCGGCAGG - Intergenic
1111021449 13:82457727-82457749 CCCATCCCTCCGGATCCGGCAGG + Intergenic
1111100905 13:83584904-83584926 TCCATCCCTCAGGATCCAGCAGG - Intergenic
1111174778 13:84580085-84580107 TCTGTCCCTCCAGATCCGGCAGG - Intergenic
1111536791 13:89612075-89612097 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1111709774 13:91796317-91796339 TCCAACCCTCCAGATCCGGCAGG - Intronic
1111820403 13:93206938-93206960 TCCATCCCTCCGGATCCGGCAGG + Intergenic
1111910267 13:94303030-94303052 CCCACCCCTCCGGATCCCGCGGG - Intronic
1113147810 13:107228461-107228483 TTCACCCCTCCCGACCCTGCAGG - Intronic
1113534727 13:111056644-111056666 TCCATCTCTCCAGATCCGGCAGG + Intergenic
1114383854 14:22236778-22236800 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1114384830 14:22243825-22243847 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1114840846 14:26260627-26260649 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1115151666 14:30293309-30293331 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1115757570 14:36544475-36544497 TCTATCCCTCCGGATCCGGCAGG - Intergenic
1116118800 14:40694710-40694732 CCCATCCCTCCGGATCCAGCAGG - Intergenic
1116740333 14:48746745-48746767 CCCATCCCTCCAGATCCAGCAGG + Intergenic
1117171816 14:53108170-53108192 TCCATCCCTCCGGATCCGGCAGG + Intronic
1118453510 14:65925211-65925233 CCCAACCCTCCGGATCCGGCAGG - Intergenic
1119089936 14:71772171-71772193 TCCATCCCTCCAGATCTGGCAGG - Intergenic
1120097383 14:80403905-80403927 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1120107979 14:80517932-80517954 TCCACCCCTCTGGATCTGGCAGG - Intronic
1120341441 14:83225740-83225762 TCCATCCCTCTGAATCCGCCAGG + Intergenic
1120397390 14:83985626-83985648 TCCATCCCTCTGGATCCGGCAGG + Intergenic
1122001011 14:98653554-98653576 TCCATCCTTCCAGATCCAGCAGG + Intergenic
1123125466 14:105942911-105942933 TCCATCCCTCCGGATCCATCAGG + Intergenic
1123987299 15:25657075-25657097 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1126153882 15:45547349-45547371 TCCCCCCCTCCAGATCCGGCAGG - Intergenic
1126687464 15:51261012-51261034 CCCACCTCTCCGGATCCAGCAGG + Intronic
1126728335 15:51655590-51655612 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1127074512 15:55312191-55312213 TCCATCCCTCCGGATCCAGCAGG - Intronic
1128363105 15:66976438-66976460 TCCACCCCTCCGGATCCAGCAGG - Intergenic
1129776371 15:78239283-78239305 GCCATCCGTCTGGATCCGGCAGG - Intronic
1130825965 15:87546648-87546670 TCTGTCCCTCTGGATCCGGCAGG - Intergenic
1130964784 15:88689074-88689096 TCCACTCCTCCACATCAGGCTGG + Intergenic
1131367667 15:91853748-91853770 TCCACCTCTCCAGCCCCGGCAGG + Exonic
1131420116 15:92298311-92298333 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1131515172 15:93072499-93072521 TCCACCCCTGGGCACCCGGCAGG + Intronic
1131629148 15:94157690-94157712 TCCACTCCTCCAGAGCTGGCAGG + Intergenic
1131673853 15:94651184-94651206 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1136485594 16:30570030-30570052 TCCACCGCTCCTGCTCCGGGGGG - Exonic
1140205173 16:72927668-72927690 CCCGCCCCTCCGGAGCCGCCCGG + Intronic
1141298461 16:82791641-82791663 TCCACCCCTCTGGATCCAGCAGG + Intronic
1142031233 16:87839552-87839574 TCCACCCCTCCGGGTAGGGGAGG + Intronic
1142278311 16:89134453-89134475 TCTATTCCTCCGGATCCCGCAGG - Intronic
1143508843 17:7384288-7384310 TGCTGCCCTCCGGATCCGCCCGG - Intronic
1143557002 17:7668167-7668189 TCCTCCCCTCCGGCCACGGCTGG - Intronic
1148371987 17:47106715-47106737 TCCATTCCTCCGGATCCAGCAGG - Intergenic
1148826724 17:50399281-50399303 TCCACCCCTCTGGATCTGGCAGG - Intergenic
1149243104 17:54673729-54673751 TCCATCCCTCCAGATCCAGCAGG - Intergenic
1151017853 17:70577631-70577653 TCCACACCCCCGGATCCGGCAGG + Intergenic
1151224451 17:72638394-72638416 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1151712245 17:75813439-75813461 TCCACCGCTCCTGATCCTGAGGG + Intronic
1153402062 18:4692049-4692071 TCCATCCCTTCGGATCCGGCAGG + Intergenic
1154315681 18:13301521-13301543 GCCACCCCTACGGTTCCTGCTGG - Intronic
1155749234 18:29399195-29399217 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1156662245 18:39359383-39359405 TCCACCCCTCAGGGTTCGGTAGG - Intergenic
1157782198 18:50449468-50449490 TCCATCCCTTCGGATTCGGCAGG - Intergenic
1159276125 18:66223481-66223503 TCCATCCCTCCAGAACCGGCAGG + Intergenic
1159279773 18:66270431-66270453 TCCATCCCTCCAGATCCAACAGG - Intergenic
1161812019 19:6476581-6476603 TCCACCCCTCCGGACCCTCAGGG - Intronic
1163901139 19:20101127-20101149 CCTCCCCCTCCGGATCCAGCAGG + Intronic
1164173175 19:22745566-22745588 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1165823200 19:38690310-38690332 TCCACCCCTCCGGATCCAGCAGG + Intronic
1168147009 19:54425203-54425225 TTCCACCCTCCGGATCCGGCAGG - Intronic
924973615 2:153856-153878 TCCACCCCTCCGGATCCAACAGG - Intergenic
924974502 2:160340-160362 TCCACCCCTCCGGATCTGACAGG - Intergenic
925023816 2:592629-592651 TCCATCTCTCCAGAGCCGGCAGG + Intergenic
925300186 2:2806304-2806326 CCCACCCCTCCGCACACGGCCGG + Intergenic
927675625 2:25103819-25103841 GCCACCCCCCAGGATGCGGCTGG - Intronic
928319128 2:30269306-30269328 TCCATCCCTCTGGATCTAGCAGG + Intronic
928440107 2:31285136-31285158 TCCACCCCTCCGGATCCAGCAGG + Intergenic
928671900 2:33610986-33611008 TCCACCCCTCCGGATCCAGCAGG - Intergenic
928676637 2:33657587-33657609 TTCACCCCTCCGGATCTGGCAGG + Intergenic
928773662 2:34732739-34732761 TCCATCCCTCTGGATCCAGCAGG - Intergenic
929781149 2:44957938-44957960 TCCACCTCTCCGGGTCAGTCAGG + Intergenic
930485721 2:52008255-52008277 TCCACCCCTCCAGATCTGGCAGG + Intergenic
932496787 2:72149509-72149531 TCCAACCCCCGGGATCCCGCTGG + Intergenic
932917182 2:75872099-75872121 TCTATCCCTCCGGATCCGGCAGG + Intergenic
932918186 2:75879137-75879159 TCTATCCCTCCGGATCCGTCAGG + Intergenic
933121765 2:78547003-78547025 TCCACCCCTCTGGATCTGGCAGG - Intergenic
933175728 2:79170172-79170194 CCCATCCCTCAGGATCCAGCAGG - Intergenic
933328835 2:80871733-80871755 CCCATCCCTCTGGATCCAGCAGG + Intergenic
933500210 2:83101810-83101832 CCCATCCCTCCGGATCCAGCAGG + Intergenic
933556334 2:83835379-83835401 TCCATCCCTCTGGATCCTGCAGG - Intergenic
934567172 2:95347244-95347266 CCCAACCCTCCGGAGCCGGGAGG - Intronic
934672428 2:96223137-96223159 TCCACCCCTCCAGATCCAGCAGG - Intergenic
935748353 2:106209373-106209395 TCCACCCCTCCGGATCCAGCAGG + Intergenic
936157447 2:110057650-110057672 TCCACCCCTGTCGATCTGGCAGG - Intergenic
936157465 2:110057756-110057778 TCCACCCCTGTCGATCTGGCAGG - Intergenic
936187227 2:110313688-110313710 TCCACCCCTGTCGATCTGGCAGG + Intergenic
936187245 2:110313794-110313816 TCCACCCCTGTCGATCTGGCAGG + Intergenic
936387732 2:112044802-112044824 TCCATCCCTCTGGATCCAGCAGG - Intergenic
937594975 2:123661614-123661636 TCCACCCCTCCAGATCTGGCAGG + Intergenic
939134080 2:138273474-138273496 TCCATCCCTCTGGATCCAGCAGG - Intergenic
939494099 2:142907455-142907477 CCCACCCCTCTGGATCTGGCAGG - Intronic
939824470 2:146998546-146998568 TCTATCCCTCCGGATCCGGCAGG + Intergenic
940669048 2:156645186-156645208 CCCATCCCTCCGGATCTGGCAGG + Intergenic
941395558 2:164968865-164968887 TCCACTCCTCCGAATCTGGAAGG - Intergenic
942349668 2:175039311-175039333 TCCACTCCTGCGGATTCTGCTGG - Intergenic
942580688 2:177412965-177412987 TCCACCCCTCCAGATCCAGCAGG - Intronic
942830313 2:180232100-180232122 TCCACCCCTCAGGGTCCGTCAGG + Intergenic
943019261 2:182552946-182552968 CCCATCCCTCCAGATCCAGCAGG + Intergenic
943462362 2:188184643-188184665 TCCATGCCTCCGGATCTGGCAGG - Intergenic
944039786 2:195339895-195339917 TCCACCCCTCCGGATCTGGCAGG - Intergenic
945064778 2:205939587-205939609 TCCATCCCTCCGGATCCAGCAGG + Intergenic
945395004 2:209306631-209306653 TCCATCCCTCCGGATCCAGCAGG + Intergenic
948402036 2:237691825-237691847 ACCACCCCTCCGGCCCCCGCCGG - Intronic
948517650 2:238514243-238514265 TCCACCCCTCTGGATCCGGCAGG + Intergenic
1171248478 20:23632062-23632084 GCCTCCCCTCCGCAGCCGGCGGG - Intronic
1171500787 20:25591447-25591469 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1172947202 20:38698790-38698812 TCCACCCCTCTGGATCAGGCAGG + Intergenic
1173276254 20:41586285-41586307 TTCACCCCTCCGGATCCGGCAGG + Intronic
1175831232 20:61966297-61966319 TCCAGCCCTCAGGACCCGCCAGG + Intronic
1177263004 21:18753080-18753102 CCCATCCCTCCGGATCCGGCAGG - Intergenic
1177263971 21:18760107-18760129 CCCATCCCTCCGGATCCGGCAGG - Intergenic
1177426360 21:20927709-20927731 TCCACCACTCCAGATCCGGCAGG + Intergenic
1177738131 21:25118821-25118843 TCCACCCCTCCGGATCCGGCAGG + Intergenic
1177895738 21:26854856-26854878 TCCATCCCTCTAGATCTGGCAGG + Intergenic
1177896710 21:26861690-26861712 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1178491073 21:33052266-33052288 TCCACTCCTCGGGATCCGAGCGG + Intergenic
1182221366 22:28761590-28761612 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1182557479 22:31137030-31137052 TCCACCCCTCAGGTGCCCGCTGG - Exonic
1182895799 22:33858242-33858264 TCCATCCCTCTGGATCCAGCAGG - Intronic
1184989482 22:48157228-48157250 TCCACCCTTCCAGACCCAGCTGG - Intergenic
951016252 3:17735765-17735787 TCCACCCCTCCAGATCCAGCAGG - Intronic
951326068 3:21303089-21303111 TCCATCCCTCCAGATCCGGCAGG - Intergenic
951837650 3:27001181-27001203 TCCATCCCTCCAGATCTGGCAGG + Intergenic
952921709 3:38289736-38289758 TCCACCCCTCCGGATCTGGCAGG - Intronic
952922691 3:38296883-38296905 TCCACCCCTCCGAATCTGGCAGG - Intronic
953505901 3:43485306-43485328 TCCATACCTCCGGATCCGACAGG + Intronic
953515829 3:43591233-43591255 TCCATCCCTCCAGATCAGGCAGG + Intronic
954096962 3:48336055-48336077 TCCACACCTCCGGATTGGGCAGG - Intergenic
955381270 3:58440178-58440200 TCCACCCCTCTGGATCCGGCAGG - Intergenic
955410921 3:58654767-58654789 CCCACCCCACAGGACCCGGCGGG - Intronic
956564248 3:70617528-70617550 TCCATCCCTCCAGATCTGGCAGG + Intergenic
957000500 3:74877899-74877921 TCCATCCCTCCGGATCCGGCAGG - Intergenic
957296905 3:78344225-78344247 TCCATCCCTCTAGATCCAGCAGG - Intergenic
957687049 3:83515333-83515355 TCCATCCCTCCGGATGCGGCAGG + Intergenic
957895113 3:86412002-86412024 TCCACCCTTCTGGATCCGGCAGG + Intergenic
958016740 3:87946193-87946215 TCCACCCCTCTGGATCCGGCAGG - Intergenic
958091889 3:88886794-88886816 TCCACCCCTCTGGATCCGGCAGG - Intergenic
958424510 3:93965316-93965338 CCCATCCCTCCGGATCCGGAAGG + Intronic
958424513 3:93965321-93965343 GACACCCTTCCGGATCCGGAGGG - Intronic
958457045 3:94345272-94345294 TCCACCGCTCCGGATCCGACAGG - Intergenic
958629241 3:96666788-96666810 ACCATCCCTCTGGATCCGGCAGG - Intergenic
958630362 3:96675006-96675028 TACATCCCTCCGGATCTGGCAGG - Intergenic
958638552 3:96776904-96776926 TCCACCCACCCGGGTCCGGGAGG + Intergenic
959161768 3:102732774-102732796 TCCATCCCTCCGGATCCAGCAGG - Intergenic
959406348 3:105966207-105966229 TCCACCCTTCCAGATCCGGCAGG + Intergenic
959450009 3:106487160-106487182 TCCATTCTTCCGGATCCAGCAGG - Intergenic
960006984 3:112790731-112790753 TCCACCCCTCCAGATGCAGCAGG - Intronic
963492275 3:146016780-146016802 TCCATTCTTCCGCATCCGGCAGG + Intergenic
963575891 3:147060195-147060217 TCCATCCCTCCAGATCTGGCAGG + Intergenic
963915317 3:150854416-150854438 TCCATCCCTCTGGATCTGGCAGG + Intergenic
965342127 3:167503664-167503686 TCCATCCCTCTGGATCTGGCAGG - Intronic
966353274 3:179054764-179054786 TCCATGCCTCCGGATCCAGCAGG + Intronic
966511217 3:180765630-180765652 TTCACCCCTCCGGATCCGGCAGG - Intronic
966994313 3:185265058-185265080 CCCACCCCTCCGGATCCGGCAGG + Intronic
967389156 3:188938540-188938562 TCCATCCCCCTGGATCCCGCAGG - Intergenic
967623105 3:191658954-191658976 TCCATCCCTCCGCATCCAGCAGG + Intergenic
968390868 4:192100-192122 TCCAACCTTCTGGATCCAGCAGG - Intergenic
968428214 4:536853-536875 TCCAGCCCTCCGTCTCCAGCTGG - Intronic
969162623 4:5274840-5274862 TTCATCCCTCCAGATCCAGCAGG + Intronic
969642648 4:8408378-8408400 TCCATCCCTCCTTATCAGGCAGG + Intronic
969644667 4:8420788-8420810 TCCACCCCTCCGGATCCAGCAGG + Intronic
970095533 4:12459591-12459613 TCCATCCCTGCGGATCCGGCAGG + Intergenic
970440334 4:16076219-16076241 CCCACCCATCCGGATTAGGCTGG - Intronic
970738108 4:19198096-19198118 TCCATCCCTCTGGATCCAGCAGG - Intergenic
971076783 4:23158420-23158442 TCCACCCTTCCGGATCTGGCAGG + Intergenic
972766766 4:42158525-42158547 TCCATCCCTCTGGATCTGGCAGG - Intergenic
972780831 4:42285706-42285728 TCCACCTCTGCAGATCTGGCAGG - Intergenic
972781773 4:42292455-42292477 CCCACCCCTGCGGATCTGGCAGG - Intergenic
972853846 4:43082263-43082285 TCCATCCCTCCAGATCTGGCAGG + Intergenic
973205064 4:47550805-47550827 TCCACCCCTGCGGATCTGGCAGG - Intronic
974190088 4:58493378-58493400 TCCATCCCTCCAGATCTGGCAGG - Intergenic
974190477 4:58496509-58496531 TCCACCCCTCTGGATCTGGCGGG - Intergenic
974487287 4:62522474-62522496 TCTACCCCTCCGGATCCAGCAGG + Intergenic
974487845 4:62526852-62526874 TCCATCCCTCTGGATCTGGCAGG - Intergenic
974519965 4:62971438-62971460 TCCAGCCCTCCGGATCCGGCAGG + Intergenic
974520766 4:62977423-62977445 TCCACCCCTCCAGATCCAGCAGG + Intergenic
974648493 4:64724939-64724961 ACCACCCCTCTGGATCCAGCAGG - Intergenic
974841801 4:67307640-67307662 TCCACCTCTCCAGATCCGGCAGG + Intergenic
975313221 4:72925982-72926004 TCCATCCCTCTGGATCCGGCAGG - Intergenic
975314186 4:72932744-72932766 TCCATCCCTCCGGATCTGGCAGG - Intergenic
975418814 4:74138633-74138655 TCCACTCCTCCGGATCCAGCAGG - Intronic
976189294 4:82473737-82473759 TCCACCCCTCCGGATCCAGCAGG + Intergenic
976190174 4:82479758-82479780 TCCACCCCTCCGGATCCGGCAGG + Intergenic
976464845 4:85355198-85355220 TCCACCCCTCCGGATCTGGCAGG - Intergenic
976963615 4:91009085-91009107 TCCATCCCTCCAGATCTGGCAGG - Intronic
977251326 4:94692670-94692692 TCCACCCCTCTGGATCCGGTAGG + Intergenic
977342094 4:95771780-95771802 TCCACTCCTCCAGATCCAGCAGG + Intergenic
977556182 4:98489623-98489645 TCCACCCCTCCGGATCCGGCAGG + Intronic
977618433 4:99109774-99109796 TCCACCACTCCAGATCCAGCAGG - Intergenic
978587022 4:110284257-110284279 TCCATCCCTCCGAATCCGGCAGG - Intergenic
978909025 4:114044543-114044565 TCCATCCCTCCGGATCCAGCAGG + Intergenic
979136001 4:117113854-117113876 TCTATCCCTCCAGATCGGGCAGG - Intergenic
979910835 4:126363717-126363739 TCCATCCCTCCAGATCTGGCAGG + Intergenic
980190525 4:129519370-129519392 TCCATCCCTCTGGATCCCGCAGG + Intergenic
980523656 4:133961758-133961780 TCCACCCCTCCAGATACGGCAGG + Intergenic
980625722 4:135372343-135372365 TCCATCCCTCTGGTTCCAGCAGG + Intergenic
980683943 4:136201412-136201434 TCCATCCTTCCGGATCTGGCAGG + Intergenic
980790437 4:137613313-137613335 TCCATCCCTGCGGATCCTGCAGG + Intergenic
980871966 4:138622093-138622115 TCCACCCCTCCAGATCCAGCAGG - Intergenic
981740764 4:147999479-147999501 TCCATCCCTCCGGATCCGGCAGG + Intronic
981823748 4:148915635-148915657 TCCACTCCCCCAGATCCTGCAGG + Intergenic
982332117 4:154192514-154192536 TCTACCCCTCCAGATCCGACAGG + Intergenic
983777801 4:171629925-171629947 TCCATCCCTCTGGATCCGGCAGG + Intergenic
984280664 4:177666599-177666621 TCCACCCCTCCAGACCCAGCAGG - Intergenic
985226362 4:187765562-187765584 CCCATCCCTCCGGATCCAGCAGG + Intergenic
985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG + Intergenic
986492612 5:8307803-8307825 TCCACACCTCAGGATCCGGCAGG - Intergenic
986918836 5:12660719-12660741 TCCATCCCTCCGGATCCACCAGG - Intergenic
987032162 5:13986143-13986165 TCATCCCCTCCGCCTCCGGCAGG - Intergenic
987129617 5:14848565-14848587 TCCACCCCTCCAGATTCGGCAGG + Intronic
987502698 5:18733523-18733545 TCCATCCCTTCGGATCCGGCAGG - Intergenic
987508232 5:18800469-18800491 TCCATCCCTCCGGATCCGGCAGG + Intergenic
987719409 5:21615309-21615331 TCCACCCTTCTGGATCTGGCAGG - Intergenic
987761177 5:22164440-22164462 TCCATCCCTCAGGATCCAGCAGG - Intronic
987855130 5:23411345-23411367 TCCACCCCTCCGGATCCAGCAGG + Intergenic
987934901 5:24451246-24451268 TCCACCCCTCCAGATCCGGCAGG - Intergenic
987934912 5:24451313-24451335 TCCACCCCTCCGGATCCAGCAGG - Intergenic
988099680 5:26660307-26660329 TCCACCCCTCCGGATCTGACAGG - Intergenic
988182548 5:27816270-27816292 TCCACCCCTCTGGATCCCGCAGG - Intergenic
988957391 5:36332935-36332957 TCCATCCTTCTGGATCCAGCAGG - Intergenic
989011578 5:36877365-36877387 TCCCCGCCACCGGAGCCGGCCGG - Intronic
989717704 5:44483537-44483559 TCCACCCCTCTGGATCCGGAAGG + Intergenic
990478810 5:56187586-56187608 TCTATCCCTCTGGATCCAGCAGG + Intronic
990564445 5:57015187-57015209 TCAACCCCTCCAGATCCAGCAGG - Intergenic
990741380 5:58915965-58915987 TCTATCCCTCTGGATCTGGCAGG + Intergenic
990891814 5:60658916-60658938 TCCACCCCTCCGGATCCAGCAGG + Intronic
990892811 5:60666122-60666144 TCCACCCCTCCAGATCCGGGAGG + Intronic
990905185 5:60795660-60795682 TCCAACCCTCCGGATCCGGCAGG + Intronic
991290618 5:65030901-65030923 TCCATCCGTCCAGATCCAGCAGG + Intergenic
991895967 5:71397894-71397916 TCCATCCCTCAGGATCCAGCAGG - Intergenic
992069630 5:73136836-73136858 ACCCCCCCTCCAGATGCGGCTGG + Intergenic
992293502 5:75304615-75304637 TCCACCCCTCTGGATCTGGCAGG + Intergenic
993054983 5:82970943-82970965 TCCATCCCTCCGGATCCAGCAGG - Intergenic
993225648 5:85165371-85165393 CCCATCCCTCCAGATCCAGCAGG + Intergenic
993460752 5:88177685-88177707 CCCATCCCTCCAGATCTGGCAGG - Intergenic
993622819 5:90188233-90188255 TCCACCCCTCTGGATCCAGCAGG - Intergenic
993941850 5:94068347-94068369 TCCACCCCTCCGGATCTGGCAGG - Intronic
993982343 5:94557937-94557959 TCCATCCCTCTGGATCTGGCAGG + Intronic
994763323 5:103884308-103884330 TCCATTCCTCCGGCTCAGGCTGG - Intergenic
995125590 5:108574444-108574466 TCCATCCCTCCAGATCCAGCAGG - Intergenic
995388295 5:111612227-111612249 TCCACCCCGTGGGATCCTGCGGG - Intergenic
995466158 5:112451138-112451160 TCCATCCCTCCAGATCTGGCAGG + Intergenic
995717284 5:115092661-115092683 TCCACCCCTCCGGATCTGGCAGG + Intergenic
995785075 5:115819045-115819067 TCCACCCCTCCAGATCCGGCAGG - Intergenic
996128278 5:119751570-119751592 TCCATCCCTCCAGATCCGGCAGG + Intergenic
996939809 5:128990897-128990919 TCCACCCCTCCAGATCCAGCAGG - Intronic
997309277 5:132866467-132866489 TCCACCCCACCGGCCCGGGCAGG + Intronic
998122118 5:139587294-139587316 TCCATCCCTCCGGATGGAGCAGG - Intronic
998644320 5:144045579-144045601 TCCATCCCTCCAGATCCAGCAGG + Intergenic
998665970 5:144297980-144298002 TTCATCCCTCTGGATTCGGCAGG + Intronic
999151423 5:149428824-149428846 TCCACCTCTCCAGCTCTGGCCGG - Intergenic
1000095458 5:157967415-157967437 TCCATCCCTCCGGAACCGGCAGG + Intergenic
1001563782 5:172686725-172686747 TTCTCCCCACCGGAGCCGGCAGG + Exonic
1001597150 5:172905653-172905675 TCCACCCCTCTGGATCCGGCAGG - Intronic
1001657172 5:173360579-173360601 TCCTTCCCTCAGGATCCTGCAGG + Intergenic
1002312810 5:178324897-178324919 CCCACCCCTCCAGATCCGAGTGG + Intronic
1004007317 6:11649082-11649104 TCCACCCCTCTGGATCCGTCAGG + Intergenic
1004236364 6:13878501-13878523 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1004256418 6:14068853-14068875 TCCATCCCTCCGGATCTGGCAGG + Intergenic
1005324132 6:24682631-24682653 CCCATCCCTCCGGATCCAGCAGG - Intronic
1007011959 6:38426568-38426590 TCCATTCTTCCGGATCCGGCAGG + Intronic
1007779813 6:44246388-44246410 TCCGCCTCTCCGGCTGCGGCCGG - Intronic
1008085773 6:47242601-47242623 TCCCTCCCTCCGGAGCCAGCTGG - Intronic
1008582769 6:52921472-52921494 TCCATACCTCTGGATCCAGCAGG - Intergenic
1009023938 6:57975009-57975031 TCCACCCATCTGGATCCAGCAGG + Intergenic
1009199510 6:60726548-60726570 TCCTCCCATCCGGATCCAGCAGG + Intergenic
1009519542 6:64664029-64664051 TCCATCCCTCCAGATCGGGCAGG - Intronic
1009702465 6:67201759-67201781 TCCACCCCTCTGGATATCGCAGG + Intergenic
1009885212 6:69617070-69617092 TCAACCCCTCTGGATCTGGCAGG + Intergenic
1010895034 6:81351523-81351545 TCCATTCTTCCGGATCTGGCAGG + Intergenic
1011076392 6:83443925-83443947 TTCACCCCTCCGGCTCCAGCAGG + Intergenic
1011189081 6:84712022-84712044 TCCACCCCTCTGGATCTGGCAGG - Intronic
1011540385 6:88421314-88421336 CCCATCCCTCTGAATCCGGCAGG - Intergenic
1012120021 6:95354775-95354797 TCCACCCCTCCGGATCCAGCAGG + Intergenic
1012734534 6:102921657-102921679 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1013021762 6:106228300-106228322 TCCATCCCTCTGGATCTAGCAGG + Intronic
1013410513 6:109879645-109879667 TCCACCCCTCTGGATCTGGCAGG + Intergenic
1013534878 6:111054876-111054898 TCCAGCCCTCCGTATCAGCCAGG - Intergenic
1013543080 6:111131183-111131205 TCCACCCCTCTGGATCCGGCAGG + Intronic
1014208918 6:118687798-118687820 TCCATCCCTCCAGATCTGGCAGG + Intronic
1014243346 6:119041703-119041725 TCCACCCCTCCGGATCCGGCAGG + Intronic
1015632771 6:135247990-135248012 TCCACCCCTCTGGATCCAGCAGG + Intergenic
1016444920 6:144121378-144121400 TCCACCCCTCCGGATCCAGCAGG - Intergenic
1017868999 6:158470200-158470222 CCCATCCCTCCGAATCTGGCAGG - Intronic
1018760556 6:166891238-166891260 TCCATCCCTCCGGATCCTGCAGG + Intronic
1019375815 7:691397-691419 TGCACCCCTCCTGACCAGGCAGG - Intronic
1020906213 7:14067256-14067278 TCCATCCCTCCAGATCTGGCAGG + Intergenic
1021126223 7:16853392-16853414 TTCACCTCTCCAGATCCAGCAGG + Intergenic
1021144259 7:17065946-17065968 TCCACCCCTCCAGATCGGGCAGG + Intergenic
1021885335 7:25131907-25131929 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1022117659 7:27276511-27276533 TCCATCCCTCCAGATCCAGCAGG + Intergenic
1023282927 7:38590339-38590361 TCTACCCCTCCAGATCTGGCAGG - Intronic
1023438996 7:40167776-40167798 TCCACCCCTCCAGATCTGGCAGG - Intronic
1023439767 7:40173322-40173344 TCCACCCCTCCGGATCTGGCAGG - Intronic
1023733130 7:43210798-43210820 TCCACCCCTCTGGATCTGGCAGG - Intronic
1025716571 7:63962593-63962615 CCCATCCCTCCAGATCCGGCAGG - Intergenic
1026213087 7:68324155-68324177 CCCATCCCTCCGGATCCAGCAGG + Intergenic
1026346976 7:69482851-69482873 TCCACCCCTCCAGATCCGGCAGG + Intergenic
1026665505 7:72337048-72337070 TCTACCCCTCCCGCTCCCGCTGG + Intronic
1027677957 7:81182297-81182319 TTTACCCCTCCGGATCTGGCAGG - Intronic
1027868358 7:83675030-83675052 TCCATACCTCCGGATCCGGCAGG - Intergenic
1028013990 7:85684151-85684173 TCCATCCCTCCAGATCCAGCAGG + Intergenic
1028147061 7:87330028-87330050 TCCACCCCTCTGGATCCAGCAGG - Intergenic
1028298665 7:89169134-89169156 TTCACTCCTCCGGATGGGGCAGG - Intronic
1028589083 7:92477752-92477774 CCCATCCCTCTGGATCCTGCAGG - Intronic
1028926145 7:96358677-96358699 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1028993392 7:97074836-97074858 TCCATCCCTCCGGATCCGACAGG + Intergenic
1029015976 7:97315977-97315999 TCCATCCCTCTGGATCTGGCAGG + Intergenic
1030336813 7:108337450-108337472 TCCATCCCTCTGGATCTGGCAGG + Intronic
1030431260 7:109452223-109452245 TCCACCCCTCCGAATCCCGCAGG + Intergenic
1030661154 7:112221079-112221101 TCCACCCTTCCAGATCCAGCAGG + Intronic
1030843974 7:114386115-114386137 CCCATCCCTCTGGATCCGGCAGG - Intronic
1031250870 7:119378910-119378932 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1031299580 7:120047510-120047532 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1031472004 7:122177235-122177257 TCCACCCCTCCGGATCCATCAGG + Intergenic
1031742820 7:125455899-125455921 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1032425785 7:131821158-131821180 CCCACCCCTCTGGATCCGGCAGG - Intergenic
1032653849 7:133906730-133906752 TCCATCCCTCCAGATCCGGCAGG + Intronic
1032725347 7:134585843-134585865 TCCACCTCTCTGGATCAGGCAGG + Intergenic
1032726299 7:134592676-134592698 TCCACCTCTCTGGGTCCAGCAGG + Intergenic
1034248773 7:149671741-149671763 TCCACCCCTCTGGATCTGGCAGG + Intergenic
1034249501 7:149676861-149676883 TCCACCCTTCTGGATCCAGCAGG + Intergenic
1034650838 7:152688821-152688843 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1034707072 7:153155164-153155186 TCCACCCCTCTGGATTTGGCAGG - Intergenic
1034965005 7:155385366-155385388 TCCATCCCTCCGGATCCAGCAGG - Intronic
1037379953 8:18274616-18274638 TCCACCCCTCAGGATCCAGCAGG - Intergenic
1037570609 8:20154880-20154902 TCCACCCCTCCAGATCTGGCAGG + Intronic
1037648685 8:20817020-20817042 TCCATCCCTCCGGATCCGTCAGG - Intergenic
1037794759 8:21983608-21983630 TCCACTCCTGAGGATTCGGCTGG + Intronic
1038742245 8:30225902-30225924 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1040768448 8:50944261-50944283 TCCACCCCTCCGGATCCAGCAGG - Intergenic
1041664088 8:60425332-60425354 TCCACCCCTCGGGATCCGGCAGG - Intergenic
1041741909 8:61165198-61165220 TCCATTCTTCCGGATCCAGCAGG - Intronic
1042055660 8:64763121-64763143 TCCACCCCTCCGGATCCAGCAGG + Intronic
1042292933 8:67188699-67188721 TCCACCCCTCCGGATCTGGCAGG + Intronic
1044988286 8:97774157-97774179 TCCACCCCTCTGGATCCGGCAGG - Intergenic
1045657595 8:104403160-104403182 TCCATCTCTCCAGATCTGGCAGG + Intronic
1045664327 8:104468972-104468994 TCCACCCCTCTGAATCCAGCAGG + Intergenic
1045863509 8:106839350-106839372 CCCACCCCTCAGGATCCGGCAGG - Intergenic
1047276658 8:123410807-123410829 TCTATCCCTCCAGATCCGGCAGG + Intronic
1047443555 8:124900101-124900123 TTCACCCCTCTGGATCTGGCAGG - Intergenic
1047599740 8:126413926-126413948 TCCACCCCTCCAGATCCGGTAGG - Intergenic
1047618318 8:126581367-126581389 TCCACCCCTCCGGATCTGGCAGG + Intergenic
1048100252 8:131343186-131343208 TCCACCCTTCTGGATCCGGCAGG - Intergenic
1049586991 8:143436870-143436892 GCCATCCCACCCGATCCGGCTGG + Intergenic
1050116053 9:2264561-2264583 TCCACCCCTCCGGATCCGGCAGG - Intergenic
1050593506 9:7183587-7183609 TCCATCCCTCTGGATCAGGCAGG + Intergenic
1051265798 9:15307285-15307307 TCCCCGCCCCCGGAGCCGGCAGG + Exonic
1051699188 9:19801376-19801398 TCCATCCCTCGGCATCCAGCAGG - Intergenic
1051870081 9:21727307-21727329 TCCATCCCTTCAGATCCGGCAGG + Intergenic
1051970171 9:22878031-22878053 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1053134328 9:35640621-35640643 CCCATCCCTCCAGATCCGGCAGG - Intronic
1053215198 9:36265055-36265077 TCCACCCCTCCGGATCTGGCAGG + Intronic
1053772723 9:41498744-41498766 TCCACCCCTCTGGCTCTGCCGGG + Intergenic
1054340676 9:63859344-63859366 TCCACCCCCGCGAATCCGGTGGG - Intergenic
1055049590 9:71964992-71965014 TCCATCCCTCTGGATCCGGTAGG - Intronic
1055431337 9:76247178-76247200 TCCATCCCTCCAGATCAGGCAGG - Intronic
1055455702 9:76469651-76469673 TCCATCCCTCTGGATCAGGCAGG + Intronic
1056705007 9:88944237-88944259 TCCATCCCTCTGGATCTGGCAGG - Intergenic
1056763000 9:89428010-89428032 TCCACCCCTCAGGGCCAGGCGGG - Intronic
1058379329 9:104361417-104361439 TCCTCCCCTCCGCAAACGGCGGG - Intergenic
1061004267 9:127919540-127919562 TCCACCCATCTGGATCCCACAGG - Intergenic
1062408083 9:136407296-136407318 TCCACCCCGTCGGAGCTGGCAGG - Exonic
1185560918 X:1060118-1060140 TCCACCCCTCCGGATCAGGCAGG + Intergenic
1186254530 X:7703881-7703903 TCCATCCCTCTGGATCCGGCAGG - Intergenic
1187613823 X:20971900-20971922 TCCATCCCTCAGGATCTGCCAGG + Intergenic
1188157317 X:26755944-26755966 CCACCCCCTCTGGATCCGGCAGG - Intergenic
1188285592 X:28322534-28322556 ACCCCTCCTCCGGATCCGGCAGG + Intergenic
1189152092 X:38719467-38719489 TCCAACCCTCCAGATCCAGCAGG - Intergenic
1189954270 X:46261957-46261979 TCCATCCCTCCGGATCTGGCAGG - Intergenic
1190240566 X:48654946-48654968 TCCATCCCTCCAGATCCGGCAGG + Intergenic
1190368109 X:49716716-49716738 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1191167480 X:57405516-57405538 TCCACCACTCTGGATCTGGCAGG - Intronic
1192254881 X:69448023-69448045 TCCACCCCTCCAGATCTGGCAGG + Intergenic
1192571980 X:72213584-72213606 TCCACCCCTCCAGATATGGCAGG + Intronic
1192803103 X:74485840-74485862 TCCACCCCTCCGGATCCGGCAGG - Intronic
1192961003 X:76130783-76130805 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1193172381 X:78350329-78350351 TCCTCCCCTCTGGATCCAGCAGG - Intergenic
1193295488 X:79827524-79827546 TCCATCCCTCCGGATATGGCAGG - Intergenic
1194103275 X:89734543-89734565 TCCATCCCTCCGGATCCCGCAGG - Intergenic
1194154499 X:90370256-90370278 TCCATCTCTCTGGATCCGGCAGG - Intergenic
1194445394 X:93981448-93981470 TCCATCACTCCGGATCCGGTAGG - Intergenic
1195243674 X:102977855-102977877 TTCACCCCTCCGGATCCAGCAGG + Intergenic
1195256577 X:103096818-103096840 TCCACCCCTCCGGATCCAGCAGG + Intergenic
1195259084 X:103115358-103115380 TCTACCCCTCCAGATCCAGCAGG - Intergenic
1195505076 X:105647191-105647213 TCCACCCCTCCGGATCTGGCAGG - Intronic
1195584610 X:106551435-106551457 TCCATCCCTCTGGATCTGGCAGG + Intergenic
1196258164 X:113547159-113547181 TCCATCGCTCCGGATCCGGCAGG - Intergenic
1196287273 X:113897427-113897449 CCCATCCCTCCGGATCCAGCAGG - Intergenic
1196772520 X:119309112-119309134 TCCATCCCTCCGGATCCAGCAGG - Intergenic
1196993638 X:121356666-121356688 TTCACCCCTCCAGATCCCGCAGG + Intergenic
1197545321 X:127816560-127816582 TCCATCCCTCCGGATCCGGCAGG - Intergenic
1197999711 X:132420303-132420325 TCCACCCCTCCAGATCCGGCAGG - Intronic
1198566834 X:137913867-137913889 TCCATCCCTCCAGATCCGGCAGG - Intergenic
1198862336 X:141084391-141084413 TCCACTCCTCCAGATCCAGCAGG + Intergenic
1198900358 X:141502995-141503017 TCCACTCCTCCAGATCCAGCAGG - Intergenic
1199268780 X:145858461-145858483 TCCATCCCTCCAGATACGGCAGG - Intergenic
1199368814 X:147020947-147020969 CCCATCCCTCCAGATCCGGCAGG + Intergenic
1199432082 X:147773211-147773233 TCCATTCTTCAGGATCCGGCAGG + Intergenic
1200069019 X:153518646-153518668 CCCACCCCTCCTCAGCCGGCTGG - Intronic
1200415976 Y:2910310-2910332 TCCACCCCTCCAGATCCAGCAGG - Intronic
1200500852 Y:3947149-3947171 TCCATCTCTCTGGATCCGGCAGG - Intergenic
1200762688 Y:7054628-7054650 TCCATCCCTCCAGATCTGGCAGG + Intronic
1200851259 Y:7886364-7886386 TCCACCCCTCTGGATCCAGCAGG - Intergenic
1201329236 Y:12800047-12800069 TCCACCCCTCCAGATCTGGCAGG + Intronic
1201421479 Y:13804588-13804610 TCCACCCCTCCAGATCCAGCAGG + Intergenic
1201642240 Y:16192157-16192179 TCCACCCCTCCAGATCTGGCAGG - Intergenic
1201660575 Y:16393164-16393186 TCCACCCCTCCAGATCTGGCAGG + Intergenic
1201723816 Y:17132993-17133015 TCCAACCCTCTGAATCTGGCAGG - Intergenic
1201905234 Y:19080360-19080382 TCCATCCCTCTGGATCCAGCAGG + Intergenic
1201906117 Y:19087156-19087178 TACACCCCTCCAGATCCAGCAGG + Intergenic
1201962277 Y:19694669-19694691 CCCACCCCTCCAGATCCAGCAGG - Intergenic
1202062378 Y:20900867-20900889 TCCATCCCTCCAGATCTGGTGGG + Intergenic