ID: 1050116055

View in Genome Browser
Species Human (GRCh38)
Location 9:2264571-2264593
Sequence ACTGCTGACTTCCACCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050116055_1050116061 13 Left 1050116055 9:2264571-2264593 CCGGAGGGGTGGAAGTCAGCAGT No data
Right 1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG No data
1050116055_1050116059 -7 Left 1050116055 9:2264571-2264593 CCGGAGGGGTGGAAGTCAGCAGT No data
Right 1050116059 9:2264587-2264609 CAGCAGTGGGTCTGCGACGGAGG No data
1050116055_1050116058 -10 Left 1050116055 9:2264571-2264593 CCGGAGGGGTGGAAGTCAGCAGT No data
Right 1050116058 9:2264584-2264606 AGTCAGCAGTGGGTCTGCGACGG No data
1050116055_1050116060 9 Left 1050116055 9:2264571-2264593 CCGGAGGGGTGGAAGTCAGCAGT No data
Right 1050116060 9:2264603-2264625 ACGGAGGCAATCAGCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050116055 Original CRISPR ACTGCTGACTTCCACCCCTC CGG (reversed) Intergenic
No off target data available for this crispr