ID: 1050116061

View in Genome Browser
Species Human (GRCh38)
Location 9:2264607-2264629
Sequence AGGCAATCAGCAGCAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050116054_1050116061 19 Left 1050116054 9:2264565-2264587 CCGGATCCGGAGGGGTGGAAGTC 0: 31
1: 87
2: 117
3: 65
4: 76
Right 1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG No data
1050116053_1050116061 23 Left 1050116053 9:2264561-2264583 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG No data
1050116051_1050116061 24 Left 1050116051 9:2264560-2264582 CCCTGCCGGATCCGGAGGGGTGG 0: 14
1: 74
2: 165
3: 149
4: 153
Right 1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG No data
1050116055_1050116061 13 Left 1050116055 9:2264571-2264593 CCGGAGGGGTGGAAGTCAGCAGT No data
Right 1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050116061 Original CRISPR AGGCAATCAGCAGCAGTGGA TGG Intergenic
No off target data available for this crispr