ID: 1050116584

View in Genome Browser
Species Human (GRCh38)
Location 9:2269746-2269768
Sequence TTCGGTATCTACTCTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050116584_1050116585 -10 Left 1050116584 9:2269746-2269768 CCAGAGACAGAGTAGATACCGAA No data
Right 1050116585 9:2269759-2269781 AGATACCGAATAAATATTGACGG No data
1050116584_1050116587 0 Left 1050116584 9:2269746-2269768 CCAGAGACAGAGTAGATACCGAA No data
Right 1050116587 9:2269769-2269791 TAAATATTGACGGATTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050116584 Original CRISPR TTCGGTATCTACTCTGTCTC TGG (reversed) Intergenic
No off target data available for this crispr