ID: 1050117118 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:2274681-2274703 |
Sequence | TATTATATTTAAAAAGTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050117111_1050117118 | 26 | Left | 1050117111 | 9:2274632-2274654 | CCAGAACTTGGAAGTGATTCTGG | No data | ||
Right | 1050117118 | 9:2274681-2274703 | TATTATATTTAAAAAGTGGGTGG | No data | ||||
1050117110_1050117118 | 27 | Left | 1050117110 | 9:2274631-2274653 | CCCAGAACTTGGAAGTGATTCTG | No data | ||
Right | 1050117118 | 9:2274681-2274703 | TATTATATTTAAAAAGTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050117118 | Original CRISPR | TATTATATTTAAAAAGTGGG TGG | Intergenic | ||
No off target data available for this crispr |