ID: 1050117118

View in Genome Browser
Species Human (GRCh38)
Location 9:2274681-2274703
Sequence TATTATATTTAAAAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050117111_1050117118 26 Left 1050117111 9:2274632-2274654 CCAGAACTTGGAAGTGATTCTGG No data
Right 1050117118 9:2274681-2274703 TATTATATTTAAAAAGTGGGTGG No data
1050117110_1050117118 27 Left 1050117110 9:2274631-2274653 CCCAGAACTTGGAAGTGATTCTG No data
Right 1050117118 9:2274681-2274703 TATTATATTTAAAAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050117118 Original CRISPR TATTATATTTAAAAAGTGGG TGG Intergenic
No off target data available for this crispr