ID: 1050121918

View in Genome Browser
Species Human (GRCh38)
Location 9:2316822-2316844
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050121918_1050121922 -10 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121918_1050121930 30 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121918_1050121924 -3 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121924 9:2316842-2316864 AGAAGTGCCATCCAGGAGCCAGG No data
1050121918_1050121929 19 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121918_1050121925 -2 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121925 9:2316843-2316865 GAAGTGCCATCCAGGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050121918 Original CRISPR TCTGGACCTACCCAGGGACT GGG (reversed) Intergenic
No off target data available for this crispr