ID: 1050121922

View in Genome Browser
Species Human (GRCh38)
Location 9:2316835-2316857
Sequence TAGGTCCAGAAGTGCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050121912_1050121922 10 Left 1050121912 9:2316802-2316824 CCTTCAGGGCAGCGAGTTCCCCC 0: 6
1: 36
2: 94
3: 267
4: 722
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121909_1050121922 15 Left 1050121909 9:2316797-2316819 CCTCCCCTTCAGGGCAGCGAGTT No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121911_1050121922 11 Left 1050121911 9:2316801-2316823 CCCTTCAGGGCAGCGAGTTCCCC 0: 6
1: 43
2: 155
3: 469
4: 983
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121910_1050121922 12 Left 1050121910 9:2316800-2316822 CCCCTTCAGGGCAGCGAGTTCCC No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121916_1050121922 -8 Left 1050121916 9:2316820-2316842 CCCCCAGTCCCTGGGTAGGTCCA No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121918_1050121922 -10 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121917_1050121922 -9 Left 1050121917 9:2316821-2316843 CCCCAGTCCCTGGGTAGGTCCAG No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121908_1050121922 22 Left 1050121908 9:2316790-2316812 CCTATGTCCTCCCCTTCAGGGCA No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121905_1050121922 27 Left 1050121905 9:2316785-2316807 CCAAGCCTATGTCCTCCCCTTCA No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data
1050121904_1050121922 28 Left 1050121904 9:2316784-2316806 CCCAAGCCTATGTCCTCCCCTTC No data
Right 1050121922 9:2316835-2316857 TAGGTCCAGAAGTGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050121922 Original CRISPR TAGGTCCAGAAGTGCCATCC AGG Intergenic
No off target data available for this crispr