ID: 1050121923

View in Genome Browser
Species Human (GRCh38)
Location 9:2316840-2316862
Sequence TGGCTCCTGGATGGCACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050121923_1050121930 12 Left 1050121923 9:2316840-2316862 CCAGAAGTGCCATCCAGGAGCCA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121923_1050121929 1 Left 1050121923 9:2316840-2316862 CCAGAAGTGCCATCCAGGAGCCA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050121923 Original CRISPR TGGCTCCTGGATGGCACTTC TGG (reversed) Intergenic
No off target data available for this crispr