ID: 1050121929

View in Genome Browser
Species Human (GRCh38)
Location 9:2316864-2316886
Sequence GGACTAGAGTCAAACATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050121926_1050121929 -8 Left 1050121926 9:2316849-2316871 CCATCCAGGAGCCAGGGACTAGA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121916_1050121929 21 Left 1050121916 9:2316820-2316842 CCCCCAGTCCCTGGGTAGGTCCA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121918_1050121929 19 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121919_1050121929 18 Left 1050121919 9:2316823-2316845 CCAGTCCCTGGGTAGGTCCAGAA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121920_1050121929 13 Left 1050121920 9:2316828-2316850 CCCTGGGTAGGTCCAGAAGTGCC No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121923_1050121929 1 Left 1050121923 9:2316840-2316862 CCAGAAGTGCCATCCAGGAGCCA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121921_1050121929 12 Left 1050121921 9:2316829-2316851 CCTGGGTAGGTCCAGAAGTGCCA No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data
1050121917_1050121929 20 Left 1050121917 9:2316821-2316843 CCCCAGTCCCTGGGTAGGTCCAG No data
Right 1050121929 9:2316864-2316886 GGACTAGAGTCAAACATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050121929 Original CRISPR GGACTAGAGTCAAACATCTT AGG Intergenic
No off target data available for this crispr