ID: 1050121930

View in Genome Browser
Species Human (GRCh38)
Location 9:2316875-2316897
Sequence AAACATCTTAGGAATTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050121921_1050121930 23 Left 1050121921 9:2316829-2316851 CCTGGGTAGGTCCAGAAGTGCCA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121920_1050121930 24 Left 1050121920 9:2316828-2316850 CCCTGGGTAGGTCCAGAAGTGCC No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121926_1050121930 3 Left 1050121926 9:2316849-2316871 CCATCCAGGAGCCAGGGACTAGA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121927_1050121930 -1 Left 1050121927 9:2316853-2316875 CCAGGAGCCAGGGACTAGAGTCA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121918_1050121930 30 Left 1050121918 9:2316822-2316844 CCCAGTCCCTGGGTAGGTCCAGA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121923_1050121930 12 Left 1050121923 9:2316840-2316862 CCAGAAGTGCCATCCAGGAGCCA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121919_1050121930 29 Left 1050121919 9:2316823-2316845 CCAGTCCCTGGGTAGGTCCAGAA No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data
1050121928_1050121930 -8 Left 1050121928 9:2316860-2316882 CCAGGGACTAGAGTCAAACATCT No data
Right 1050121930 9:2316875-2316897 AAACATCTTAGGAATTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050121930 Original CRISPR AAACATCTTAGGAATTTACC TGG Intergenic
No off target data available for this crispr