ID: 1050122459

View in Genome Browser
Species Human (GRCh38)
Location 9:2321480-2321502
Sequence GGATTGAAACTCAGGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050122459_1050122466 11 Left 1050122459 9:2321480-2321502 CCCTGATCCCTGAGTTTCAATCC No data
Right 1050122466 9:2321514-2321536 TGCCCTACTCTTGCTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050122459 Original CRISPR GGATTGAAACTCAGGGATCA GGG (reversed) Intergenic
No off target data available for this crispr