ID: 1050124225

View in Genome Browser
Species Human (GRCh38)
Location 9:2339718-2339740
Sequence TTCAGTCATGTCTAGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050124225_1050124226 -5 Left 1050124225 9:2339718-2339740 CCAAATTTCTAGACATGACTGAA No data
Right 1050124226 9:2339736-2339758 CTGAACTTTCGTTTACCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050124225 Original CRISPR TTCAGTCATGTCTAGAAATT TGG (reversed) Intergenic
No off target data available for this crispr