ID: 1050130360

View in Genome Browser
Species Human (GRCh38)
Location 9:2406337-2406359
Sequence GGCTGCACACTCCGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050130351_1050130360 12 Left 1050130351 9:2406302-2406324 CCATCACGCCTGCAGCAGCAGGG No data
Right 1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG No data
1050130354_1050130360 4 Left 1050130354 9:2406310-2406332 CCTGCAGCAGCAGGGAGGCATGG No data
Right 1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050130360 Original CRISPR GGCTGCACACTCCGTGGAGC TGG Intergenic
No off target data available for this crispr