ID: 1050131753

View in Genome Browser
Species Human (GRCh38)
Location 9:2420156-2420178
Sequence TACTAGCAACAAGCCCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050131753_1050131757 16 Left 1050131753 9:2420156-2420178 CCAATGTGGGCTTGTTGCTAGTA No data
Right 1050131757 9:2420195-2420217 CAACTTTCATGAAGTATTTAGGG No data
1050131753_1050131756 15 Left 1050131753 9:2420156-2420178 CCAATGTGGGCTTGTTGCTAGTA No data
Right 1050131756 9:2420194-2420216 CCAACTTTCATGAAGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050131753 Original CRISPR TACTAGCAACAAGCCCACAT TGG (reversed) Intergenic
No off target data available for this crispr