ID: 1050136056

View in Genome Browser
Species Human (GRCh38)
Location 9:2465890-2465912
Sequence TTTGTAGTCCCCTTGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050136054_1050136056 8 Left 1050136054 9:2465859-2465881 CCAGTTGCTTTCTAGTACACGAA No data
Right 1050136056 9:2465890-2465912 TTTGTAGTCCCCTTGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050136056 Original CRISPR TTTGTAGTCCCCTTGTATGA GGG Intergenic
No off target data available for this crispr