ID: 1050138257

View in Genome Browser
Species Human (GRCh38)
Location 9:2490913-2490935
Sequence CATCCAAGCCAGGTTCTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050138247_1050138257 25 Left 1050138247 9:2490865-2490887 CCCGAGGGCGCACCTAACTCCTT No data
Right 1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG No data
1050138252_1050138257 1 Left 1050138252 9:2490889-2490911 CCTTCAAGGATGCCAAAAGCATC No data
Right 1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG No data
1050138246_1050138257 29 Left 1050138246 9:2490861-2490883 CCAGCCCGAGGGCGCACCTAACT No data
Right 1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG No data
1050138248_1050138257 24 Left 1050138248 9:2490866-2490888 CCGAGGGCGCACCTAACTCCTTG No data
Right 1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG No data
1050138250_1050138257 13 Left 1050138250 9:2490877-2490899 CCTAACTCCTTGCCTTCAAGGAT No data
Right 1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG No data
1050138251_1050138257 6 Left 1050138251 9:2490884-2490906 CCTTGCCTTCAAGGATGCCAAAA No data
Right 1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050138257 Original CRISPR CATCCAAGCCAGGTTCTACG TGG Intergenic
No off target data available for this crispr