ID: 1050141779

View in Genome Browser
Species Human (GRCh38)
Location 9:2523598-2523620
Sequence CTGCTTAGAACCAGAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050141779_1050141781 12 Left 1050141779 9:2523598-2523620 CCAAAAATTCTGGTTCTAAGCAG No data
Right 1050141781 9:2523633-2523655 AGAAATCTGTCATTACTTGCAGG No data
1050141779_1050141782 19 Left 1050141779 9:2523598-2523620 CCAAAAATTCTGGTTCTAAGCAG No data
Right 1050141782 9:2523640-2523662 TGTCATTACTTGCAGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050141779 Original CRISPR CTGCTTAGAACCAGAATTTT TGG (reversed) Intergenic
No off target data available for this crispr