ID: 1050141898

View in Genome Browser
Species Human (GRCh38)
Location 9:2524835-2524857
Sequence CTGTTCAGTGATGAGAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050141898_1050141904 13 Left 1050141898 9:2524835-2524857 CCTCATTTCTCATCACTGAACAG No data
Right 1050141904 9:2524871-2524893 TGACCCCATGGTGGTTGTGCAGG No data
1050141898_1050141901 1 Left 1050141898 9:2524835-2524857 CCTCATTTCTCATCACTGAACAG No data
Right 1050141901 9:2524859-2524881 TTGGCCTGAGTATGACCCCATGG No data
1050141898_1050141902 4 Left 1050141898 9:2524835-2524857 CCTCATTTCTCATCACTGAACAG No data
Right 1050141902 9:2524862-2524884 GCCTGAGTATGACCCCATGGTGG No data
1050141898_1050141905 14 Left 1050141898 9:2524835-2524857 CCTCATTTCTCATCACTGAACAG No data
Right 1050141905 9:2524872-2524894 GACCCCATGGTGGTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050141898 Original CRISPR CTGTTCAGTGATGAGAAATG AGG (reversed) Intergenic
No off target data available for this crispr