ID: 1050141901

View in Genome Browser
Species Human (GRCh38)
Location 9:2524859-2524881
Sequence TTGGCCTGAGTATGACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050141896_1050141901 24 Left 1050141896 9:2524812-2524834 CCAGAGTAACAGGAGTCAACAGG No data
Right 1050141901 9:2524859-2524881 TTGGCCTGAGTATGACCCCATGG No data
1050141898_1050141901 1 Left 1050141898 9:2524835-2524857 CCTCATTTCTCATCACTGAACAG No data
Right 1050141901 9:2524859-2524881 TTGGCCTGAGTATGACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050141901 Original CRISPR TTGGCCTGAGTATGACCCCA TGG Intergenic
No off target data available for this crispr