ID: 1050141905

View in Genome Browser
Species Human (GRCh38)
Location 9:2524872-2524894
Sequence GACCCCATGGTGGTTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050141898_1050141905 14 Left 1050141898 9:2524835-2524857 CCTCATTTCTCATCACTGAACAG No data
Right 1050141905 9:2524872-2524894 GACCCCATGGTGGTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050141905 Original CRISPR GACCCCATGGTGGTTGTGCA GGG Intergenic
No off target data available for this crispr