ID: 1050145084

View in Genome Browser
Species Human (GRCh38)
Location 9:2559309-2559331
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050145084_1050145094 14 Left 1050145084 9:2559309-2559331 CCCTCCCACACCCCCTGGCAGCA No data
Right 1050145094 9:2559346-2559368 AAAGAGAATATGTGTGTTGGAGG No data
1050145084_1050145095 17 Left 1050145084 9:2559309-2559331 CCCTCCCACACCCCCTGGCAGCA No data
Right 1050145095 9:2559349-2559371 GAGAATATGTGTGTTGGAGGAGG No data
1050145084_1050145093 11 Left 1050145084 9:2559309-2559331 CCCTCCCACACCCCCTGGCAGCA No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145084_1050145096 18 Left 1050145084 9:2559309-2559331 CCCTCCCACACCCCCTGGCAGCA No data
Right 1050145096 9:2559350-2559372 AGAATATGTGTGTTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050145084 Original CRISPR TGCTGCCAGGGGGTGTGGGA GGG (reversed) Intergenic