ID: 1050145091

View in Genome Browser
Species Human (GRCh38)
Location 9:2559322-2559344
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050145091_1050145093 -2 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145091_1050145098 24 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data
1050145091_1050145094 1 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145094 9:2559346-2559368 AAAGAGAATATGTGTGTTGGAGG No data
1050145091_1050145097 23 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145097 9:2559368-2559390 GAGGGAGAGCACAGTAATTTAGG No data
1050145091_1050145095 4 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145095 9:2559349-2559371 GAGAATATGTGTGTTGGAGGAGG No data
1050145091_1050145096 5 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145096 9:2559350-2559372 AGAATATGTGTGTTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050145091 Original CRISPR TGTGCTACACGGCTGCTGCC AGG (reversed) Intergenic