ID: 1050145092

View in Genome Browser
Species Human (GRCh38)
Location 9:2559333-2559355
Sequence TATTCTCTTTTTGTGCTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050145092_1050145096 -6 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145096 9:2559350-2559372 AGAATATGTGTGTTGGAGGAGGG No data
1050145092_1050145098 13 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data
1050145092_1050145094 -10 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145094 9:2559346-2559368 AAAGAGAATATGTGTGTTGGAGG No data
1050145092_1050145099 25 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145099 9:2559381-2559403 GTAATTTAGGGAATTTACATTGG No data
1050145092_1050145095 -7 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145095 9:2559349-2559371 GAGAATATGTGTGTTGGAGGAGG No data
1050145092_1050145097 12 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145097 9:2559368-2559390 GAGGGAGAGCACAGTAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050145092 Original CRISPR TATTCTCTTTTTGTGCTACA CGG (reversed) Intergenic
No off target data available for this crispr