ID: 1050145093

View in Genome Browser
Species Human (GRCh38)
Location 9:2559343-2559365
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050145090_1050145093 -1 Left 1050145090 9:2559321-2559343 CCCTGGCAGCAGCCGTGTAGCAC No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145089_1050145093 0 Left 1050145089 9:2559320-2559342 CCCCTGGCAGCAGCCGTGTAGCA No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145084_1050145093 11 Left 1050145084 9:2559309-2559331 CCCTCCCACACCCCCTGGCAGCA No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145087_1050145093 6 Left 1050145087 9:2559314-2559336 CCACACCCCCTGGCAGCAGCCGT No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145082_1050145093 15 Left 1050145082 9:2559305-2559327 CCACCCCTCCCACACCCCCTGGC No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145088_1050145093 1 Left 1050145088 9:2559319-2559341 CCCCCTGGCAGCAGCCGTGTAGC No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145083_1050145093 12 Left 1050145083 9:2559308-2559330 CCCCTCCCACACCCCCTGGCAGC No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145086_1050145093 7 Left 1050145086 9:2559313-2559335 CCCACACCCCCTGGCAGCAGCCG No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145080_1050145093 21 Left 1050145080 9:2559299-2559321 CCAATGCCACCCCTCCCACACCC No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145091_1050145093 -2 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data
1050145085_1050145093 10 Left 1050145085 9:2559310-2559332 CCTCCCACACCCCCTGGCAGCAG No data
Right 1050145093 9:2559343-2559365 CAAAAAGAGAATATGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050145093 Original CRISPR CAAAAAGAGAATATGTGTGT TGG Intergenic