ID: 1050145098

View in Genome Browser
Species Human (GRCh38)
Location 9:2559369-2559391
Sequence AGGGAGAGCACAGTAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050145089_1050145098 26 Left 1050145089 9:2559320-2559342 CCCCTGGCAGCAGCCGTGTAGCA No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data
1050145092_1050145098 13 Left 1050145092 9:2559333-2559355 CCGTGTAGCACAAAAAGAGAATA No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data
1050145091_1050145098 24 Left 1050145091 9:2559322-2559344 CCTGGCAGCAGCCGTGTAGCACA No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data
1050145090_1050145098 25 Left 1050145090 9:2559321-2559343 CCCTGGCAGCAGCCGTGTAGCAC No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data
1050145088_1050145098 27 Left 1050145088 9:2559319-2559341 CCCCCTGGCAGCAGCCGTGTAGC No data
Right 1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050145098 Original CRISPR AGGGAGAGCACAGTAATTTA GGG Intergenic
No off target data available for this crispr