ID: 1050146802

View in Genome Browser
Species Human (GRCh38)
Location 9:2576826-2576848
Sequence ACTTGGCTGTGCTCCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050146802_1050146809 22 Left 1050146802 9:2576826-2576848 CCACCTCTGGAGCACAGCCAAGT No data
Right 1050146809 9:2576871-2576893 AATGGATACAAATACTCTATGGG No data
1050146802_1050146807 4 Left 1050146802 9:2576826-2576848 CCACCTCTGGAGCACAGCCAAGT No data
Right 1050146807 9:2576853-2576875 CATGTGGGTAATATATAAAATGG No data
1050146802_1050146810 27 Left 1050146802 9:2576826-2576848 CCACCTCTGGAGCACAGCCAAGT No data
Right 1050146810 9:2576876-2576898 ATACAAATACTCTATGGGCCAGG No data
1050146802_1050146808 21 Left 1050146802 9:2576826-2576848 CCACCTCTGGAGCACAGCCAAGT No data
Right 1050146808 9:2576870-2576892 AAATGGATACAAATACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050146802 Original CRISPR ACTTGGCTGTGCTCCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr