ID: 1050148628

View in Genome Browser
Species Human (GRCh38)
Location 9:2597009-2597031
Sequence CAGTGAGATGGAGCTGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050148628_1050148636 7 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148636 9:2597039-2597061 CCCAGGACATTAGGGGGAGATGG No data
1050148628_1050148631 -2 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148631 9:2597030-2597052 TGTCATCATCCCAGGACATTAGG No data
1050148628_1050148632 -1 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148632 9:2597031-2597053 GTCATCATCCCAGGACATTAGGG No data
1050148628_1050148630 -10 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148630 9:2597022-2597044 CATCTCACTGTCATCATCCCAGG No data
1050148628_1050148633 0 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148633 9:2597032-2597054 TCATCATCCCAGGACATTAGGGG No data
1050148628_1050148639 9 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148639 9:2597041-2597063 CAGGACATTAGGGGGAGATGGGG No data
1050148628_1050148638 8 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148638 9:2597040-2597062 CCAGGACATTAGGGGGAGATGGG No data
1050148628_1050148634 1 Left 1050148628 9:2597009-2597031 CCTAAAGCAGCTCCATCTCACTG No data
Right 1050148634 9:2597033-2597055 CATCATCCCAGGACATTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050148628 Original CRISPR CAGTGAGATGGAGCTGCTTT AGG (reversed) Intergenic