ID: 1050150386

View in Genome Browser
Species Human (GRCh38)
Location 9:2614014-2614036
Sequence GGATGCATAAAGTGACGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050150378_1050150386 27 Left 1050150378 9:2613964-2613986 CCCTTACAGCTGACAAATCTAGC No data
Right 1050150386 9:2614014-2614036 GGATGCATAAAGTGACGACTGGG No data
1050150379_1050150386 26 Left 1050150379 9:2613965-2613987 CCTTACAGCTGACAAATCTAGCT No data
Right 1050150386 9:2614014-2614036 GGATGCATAAAGTGACGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050150386 Original CRISPR GGATGCATAAAGTGACGACT GGG Intergenic
No off target data available for this crispr