ID: 1050150749

View in Genome Browser
Species Human (GRCh38)
Location 9:2617242-2617264
Sequence CTTTCTATGCTGAGGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050150745_1050150749 7 Left 1050150745 9:2617212-2617234 CCAGAAGAGGACAGCTCATTTCA No data
Right 1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG No data
1050150744_1050150749 8 Left 1050150744 9:2617211-2617233 CCCAGAAGAGGACAGCTCATTTC No data
Right 1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG No data
1050150743_1050150749 9 Left 1050150743 9:2617210-2617232 CCCCAGAAGAGGACAGCTCATTT No data
Right 1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050150749 Original CRISPR CTTTCTATGCTGAGGCTGTG GGG Intergenic
No off target data available for this crispr