ID: 1050153578

View in Genome Browser
Species Human (GRCh38)
Location 9:2642210-2642232
Sequence CAAGCTACTGCCCTTTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050153577_1050153578 24 Left 1050153577 9:2642163-2642185 CCTGGGAAAATCACTAGGTTGAA 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1050153578 9:2642210-2642232 CAAGCTACTGCCCTTTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050153578 Original CRISPR CAAGCTACTGCCCTTTTTAT AGG Intronic
No off target data available for this crispr