ID: 1050153687

View in Genome Browser
Species Human (GRCh38)
Location 9:2643316-2643338
Sequence GCTGATGGGGATGCAGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 1, 2: 10, 3: 85, 4: 773}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050153687_1050153696 29 Left 1050153687 9:2643316-2643338 CCTCCTCCTGCATCCCCATCAGC 0: 1
1: 1
2: 10
3: 85
4: 773
Right 1050153696 9:2643368-2643390 CGACCAATCTGATGAGTCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050153687 Original CRISPR GCTGATGGGGATGCAGGAGG AGG (reversed) Exonic
900353856 1:2250401-2250423 GCTGATGGAGGAGCAGGAAGTGG + Intronic
900359996 1:2283850-2283872 TCTGCTGGGGCTGGAGGAGGCGG + Intronic
900420916 1:2555577-2555599 GCAGATGGGCTTGCTGGAGGTGG + Intergenic
900458611 1:2789600-2789622 GCTGGTGGTGCTGCGGGAGGAGG - Exonic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
900957119 1:5892866-5892888 TGTGAAGGGGGTGCAGGAGGTGG - Intronic
901056791 1:6452057-6452079 GCAGCTGAAGATGCAGGAGGAGG + Exonic
901194086 1:7430559-7430581 GATGATGGGGATGATGGTGGAGG + Intronic
901383847 1:8893524-8893546 GCTGAAGGGGATGCTAAAGGAGG + Intergenic
901672832 1:10866329-10866351 GCTGGTGGGGGGGCAGGTGGGGG - Intergenic
901778946 1:11579911-11579933 GCTGGTGGTGATGAAGGAGATGG + Intergenic
902168878 1:14594803-14594825 GCAAATGGGCTTGCAGGAGGGGG + Intergenic
902511089 1:16967474-16967496 GCCGCAGGGGCTGCAGGAGGAGG + Intronic
902677153 1:18016668-18016690 GGTGGTGGTGATGCAGGCGGTGG + Intergenic
902983049 1:20139256-20139278 GCTGTGGGGGAGGGAGGAGGAGG + Intergenic
903456504 1:23490950-23490972 GCTGGAGGGGCTGCAGGATGAGG - Intergenic
903628094 1:24745571-24745593 GCTGAATGGGCTGAAGGAGGAGG + Exonic
904014601 1:27409913-27409935 GCTGCTGGTGGTGGAGGAGGAGG + Exonic
904484162 1:30813982-30814004 GCGGATGTGGATGCAGGCTGTGG - Intergenic
904718045 1:32484094-32484116 GCTGCTTGGGAGGCTGGAGGGGG + Intronic
905361398 1:37423339-37423361 GGAGATGGGGAAGCAGGAGGAGG - Intergenic
905863797 1:41366214-41366236 GCTGATGGGGGTGCGGGAGGAGG + Intronic
906034357 1:42741261-42741283 GCTGTTGGGGACGGAGGGGGCGG - Intergenic
906118155 1:43368887-43368909 ACTGATGGGATTGGAGGAGGCGG + Intergenic
906128793 1:43443529-43443551 CCTGCTGGGGATGGAGGAGGGGG - Intronic
906197165 1:43936373-43936395 GCAGATGGGGGTGCAGGCGGCGG - Exonic
906613552 1:47219904-47219926 GCTGGTGGGGGTGGAGGTGGGGG - Exonic
907803155 1:57791686-57791708 GCTGTTGGATATGCAGGAGGTGG - Intronic
908462456 1:64358586-64358608 GATGATGGTGATGAAGTAGGAGG - Intergenic
910192221 1:84605918-84605940 GCTGATGGTGCAGCTGGAGGGGG - Intergenic
910809158 1:91218522-91218544 GCTGAGGGAGAAGGAGGAGGTGG - Intergenic
911096947 1:94062519-94062541 GCTAATGGGGGTGCTGGAGTGGG - Intronic
912709648 1:111941325-111941347 GCAGGTGGGGAGGTAGGAGGGGG - Intronic
912799665 1:112712982-112713004 TTTGATGGGCATGCAGGGGGCGG - Exonic
914454751 1:147825277-147825299 ATTGATGGGCATGCAGGTGGGGG - Intergenic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
915068336 1:153244626-153244648 GGTGATGGTGGTGCAGGTGGTGG + Intergenic
915170816 1:153976040-153976062 TCTGATGCGGATGGTGGAGGTGG + Intronic
915354903 1:155250332-155250354 GGTGGTGGGGATGCCGGATGAGG + Exonic
915994632 1:160550381-160550403 GCTGGTGGGGACACAGGAGAGGG + Intronic
916609328 1:166374964-166374986 GCTGATGAGGATGAAAAAGGAGG - Intergenic
918515583 1:185359129-185359151 TCTGATGGGGCAGCAGGGGGTGG - Intergenic
918536129 1:185576761-185576783 GTTGGTGGGGGTGCAGGGGGAGG - Intergenic
918703831 1:187637393-187637415 GCTATTGGGGATGGAGAAGGAGG - Intergenic
919084813 1:192909514-192909536 GATGATGGTGAGGTAGGAGGTGG + Intergenic
919737687 1:200963527-200963549 GCTGCTTGGGTTGAAGGAGGTGG - Intergenic
920006221 1:202835632-202835654 TCTGATGGGGGTGTGGGAGGAGG + Intergenic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920228662 1:204455867-204455889 GATGATGGGGATGCGGTGGGTGG + Exonic
920540159 1:206772159-206772181 GGTGTTGGGGATGGAGGTGGAGG + Intronic
921052560 1:211521408-211521430 GCTCATGGGGAGGCAGGTTGAGG + Intergenic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
921496824 1:215852819-215852841 GCTCATGCTGATGCAAGAGGTGG + Intronic
921610463 1:217206954-217206976 GGTTATGGTGATGCAAGAGGTGG - Intergenic
921813854 1:219544881-219544903 GCTGATCGGGAAGTAGGAGGAGG + Intergenic
922398047 1:225223028-225223050 GCTGAAGGAGAAGGAGGAGGTGG - Intronic
922466780 1:225849851-225849873 GCTGGTGGGGATGCAGGGCTGGG + Intronic
922564566 1:226593356-226593378 GGTGATGGGGATGAAGAGGGAGG - Intronic
923014604 1:230116629-230116651 TCTGATGGAGATGCACAAGGAGG - Intronic
923052153 1:230396409-230396431 GATGGTGGGGATGGGGGAGGAGG - Intronic
923146512 1:231202297-231202319 GGTGGTGGTGGTGCAGGAGGAGG + Intronic
923638730 1:235728696-235728718 GGTGATGAGCATGCAGGGGGCGG - Intronic
923687048 1:236160710-236160732 ACTGACGGGGAGGCTGGAGGGGG - Intronic
1063104947 10:2984840-2984862 GCTGAGGTGGATTCAGGAGAAGG + Intergenic
1063235607 10:4112429-4112451 GCTGTTGGGGGTGGAGGAGGTGG - Intergenic
1063366236 10:5492728-5492750 GCTGATGGTGGCCCAGGAGGAGG + Intergenic
1064336977 10:14452418-14452440 GGTAATGGGGATGGGGGAGGTGG + Intronic
1064635269 10:17358777-17358799 GATGATGAGGAAGAAGGAGGAGG + Intronic
1065111628 10:22445431-22445453 GCTGTTGGGGATGGAGGTGATGG + Intronic
1065327401 10:24560948-24560970 TCTTCTGGGGATGCAGGAGGAGG - Intergenic
1067693385 10:48518800-48518822 GCAGATGGGGCTGCAGGTGCTGG + Intronic
1067842939 10:49696489-49696511 GTTGAGGCGGATGCTGGAGGAGG - Intronic
1067850325 10:49750305-49750327 GCCTGTGGGGAAGCAGGAGGGGG - Intronic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1068631162 10:59298952-59298974 GCTGGTGGGGAGGAAGGAGGTGG + Intronic
1068693392 10:59941011-59941033 GCAGAAGGGGAAGCAGGAGCAGG + Intergenic
1068874780 10:61984539-61984561 GCTCATGTGGAGGCAGCAGGTGG + Intronic
1069552992 10:69377343-69377365 GCTGATGGGGGTGGGAGAGGAGG - Intronic
1069761737 10:70816050-70816072 GCTGAGGGAGACGCAGGAGGTGG + Exonic
1070393719 10:75993294-75993316 GCTGATGATGATGGAGGAGGAGG + Intronic
1070555922 10:77527725-77527747 GCTGGTGGGGAGTGAGGAGGAGG + Intronic
1070836749 10:79452255-79452277 GCTGGTGGGAATGGAGGAGAAGG - Intergenic
1071705923 10:87998377-87998399 GCAGATGGTGAAGCAGGAGCAGG + Intergenic
1071786732 10:88909228-88909250 GTTGTGGGGGAAGCAGGAGGTGG + Intronic
1072260447 10:93665359-93665381 GCTGCTGAAGATTCAGGAGGTGG + Exonic
1072574543 10:96687989-96688011 TCTGATGGGGAGGCATGAAGGGG + Intronic
1073057744 10:100713229-100713251 GCTGCTGTGGAGGCAGGGGGTGG - Intergenic
1073403914 10:103280261-103280283 GCTGATGGGAGTGGAAGAGGAGG + Intronic
1073423082 10:103440068-103440090 GTTGTTGGGGATGGTGGAGGGGG + Intronic
1073628051 10:105119618-105119640 GATCATGTTGATGCAGGAGGTGG - Intronic
1073734148 10:106326746-106326768 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1073776165 10:106788637-106788659 GGTCATGCTGATGCAGGAGGTGG + Intronic
1074396488 10:113102025-113102047 GCTACTCGGGAGGCAGGAGGCGG + Intronic
1074532209 10:114305497-114305519 GCAGGAGGAGATGCAGGAGGGGG + Intronic
1074532270 10:114305728-114305750 GGAGATGCAGATGCAGGAGGGGG + Intronic
1074532405 10:114306213-114306235 GGAGATGCAGATGCAGGAGGGGG + Intronic
1074780116 10:116796501-116796523 GGGGATGGGGAGGCAGGAGCAGG - Intergenic
1074886788 10:117700217-117700239 GCTGATGGAGATGCAGATGCTGG - Intergenic
1074903414 10:117839302-117839324 ACCGATGGGGAGCCAGGAGGGGG - Intergenic
1075543601 10:123336953-123336975 GGTGATGTTGATGCAAGAGGTGG + Intergenic
1075637872 10:124042597-124042619 GCTGCTGGGGATGGGGGTGGGGG + Intronic
1076078231 10:127554695-127554717 GCAGGTGGGGATGCAGGGCGCGG + Intergenic
1076079667 10:127567653-127567675 GCTGATGGTGATTCAGGGGATGG - Intergenic
1076206012 10:128603761-128603783 TCTGATGGAGATGCACAAGGAGG + Intergenic
1076349008 10:129801882-129801904 GCTGGAGGGGAGGCAGAAGGGGG + Intergenic
1076474470 10:130742831-130742853 GAGGCTGGGGATGCAGGATGGGG - Intergenic
1076720893 10:132392459-132392481 GGTGATGGTGATGGTGGAGGTGG + Intergenic
1076868974 10:133183442-133183464 GCTGAGCCGGATGCAGGCGGAGG + Exonic
1077321777 11:1946128-1946150 GTTGATGGAAATTCAGGAGGAGG - Intergenic
1077385900 11:2269407-2269429 GCAGATTGGGGTGCTGGAGGCGG - Intronic
1077413818 11:2415285-2415307 GCTGCAGCGGAAGCAGGAGGAGG - Exonic
1077495106 11:2883159-2883181 GCTTTTGGGGGTGCAGGAGAAGG + Intergenic
1077555651 11:3224841-3224863 GGTGGTGGGGAAGCGGGAGGCGG + Intergenic
1077836165 11:5929744-5929766 GATGATGGAGGTGGAGGAGGAGG - Intronic
1077836719 11:5932824-5932846 TCTGATGGGGATCTAGGATGGGG - Intronic
1078285289 11:9947483-9947505 GCTGATGGGGAAGAAGGGTGTGG + Intronic
1079396667 11:20069521-20069543 GCTGATGGGGGTGGGGGAAGAGG - Intronic
1081180725 11:39983520-39983542 GCAGAAGGTGAAGCAGGAGGAGG - Intergenic
1081634199 11:44710003-44710025 GCAGCAGGGGAGGCAGGAGGAGG + Intergenic
1081667391 11:44924539-44924561 TGTGTTGGGGCTGCAGGAGGTGG + Intronic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081924137 11:46809741-46809763 GCTGGTGGAGATGCTGAAGGAGG - Exonic
1081944988 11:46984023-46984045 GCTGATTGGTATGAAGGTGGGGG + Intronic
1082045530 11:47723025-47723047 GCTGGTGGTGGTGGAGGAGGAGG + Exonic
1083860546 11:65417918-65417940 GCTGGTGAAGAGGCAGGAGGAGG + Intergenic
1084175284 11:67419585-67419607 GCTGCTGGAGAAGCTGGAGGAGG + Exonic
1084207641 11:67605272-67605294 GCTGAGGGAGATGCAGGTTGGGG - Intronic
1084308051 11:68299317-68299339 GCTCAGGGGGAGGCTGGAGGTGG + Intergenic
1084404656 11:68964288-68964310 GCTGATGGGGAAACAGCAAGCGG + Intergenic
1084465859 11:69322700-69322722 AGTGATGGTGATGCTGGAGGTGG + Intronic
1084465962 11:69323224-69323246 GGTGATGGTGATGTTGGAGGTGG + Intronic
1084701142 11:70786978-70787000 GCTGGTGGTGATGCTGGTGGTGG - Intronic
1084701206 11:70787341-70787363 GCTGGTGGTGATGCTGGTGGTGG - Intronic
1085295147 11:75427302-75427324 GGTACTGGGGATGCAGGATGTGG + Intronic
1085423068 11:76380638-76380660 GCTGAGAGGGGCGCAGGAGGCGG - Intronic
1088343759 11:108799306-108799328 TTTGATGGGGATGCAGGGAGGGG - Intronic
1088904314 11:114142837-114142859 CCCGATGGGGATGGGGGAGGAGG - Intronic
1089577454 11:119455897-119455919 CCTGTTGGGGGTGCAGGAGGAGG - Intergenic
1090080711 11:123610405-123610427 CCTGACGGGGAAGGAGGAGGTGG + Intronic
1090465235 11:126927690-126927712 GCTGCTGAAGATTCAGGAGGTGG - Intronic
1090571863 11:128056027-128056049 GCTGTTGGGGATGCTGAATGGGG - Intergenic
1091076039 11:132618047-132618069 GTTGTTGGGGATGTGGGAGGGGG + Intronic
1091250868 11:134142774-134142796 GCTGCCAGGGATGCGGGAGGAGG - Intronic
1091280783 11:134380435-134380457 ACTGACGGGGCTGCAGGAGCAGG - Intronic
1091560097 12:1605627-1605649 GCAGAAGGGGAAGCAGGAGCGGG + Intronic
1091581365 12:1792433-1792455 GCTGAGGGTGATGGAGGAGCGGG + Exonic
1091800799 12:3323399-3323421 TCAGATGAGGATGCAGGCGGAGG + Intergenic
1091912726 12:4244929-4244951 GGTGATGGGGAAGGAGGAGGGGG - Intergenic
1092004611 12:5058747-5058769 GGTGATGGGGTTGCAGGACGTGG - Intergenic
1092017120 12:5168791-5168813 CAAGATGGGGATGCAGGAGCTGG + Intergenic
1092953220 12:13526747-13526769 GGAGATGGGAATGCAGGAGTGGG + Intergenic
1093509897 12:19914143-19914165 GCTAATGGGGAGGAAGGATGAGG - Intergenic
1093715197 12:22374090-22374112 GCTGATGGAGAGGGAGGAGAGGG - Intronic
1096050201 12:48600798-48600820 GGAGAAGGGGGTGCAGGAGGTGG - Intergenic
1096096608 12:48939699-48939721 GCTGATGAGAATGCTGGCGGAGG - Exonic
1096468783 12:51863800-51863822 GCTGATGGGAATGGAGCTGGTGG - Intergenic
1096482117 12:51949408-51949430 GCTGATGGAGCTGACGGAGGTGG + Intergenic
1096487269 12:51992006-51992028 GCTGATGGGAAAGCCGCAGGAGG - Intronic
1096529499 12:52234074-52234096 GCTGATGCGGATGCAGATGCTGG + Intronic
1097160310 12:57041565-57041587 GCGGATGGGGTTGGAGTAGGGGG + Intronic
1097167792 12:57094829-57094851 GCAGGTGGGGAGGCAGGAGAAGG - Exonic
1097264839 12:57738788-57738810 GGGGATGGAGATACAGGAGGCGG + Intronic
1097710424 12:62911715-62911737 GATGATGGGCATGCAGTAGAGGG - Intronic
1097818131 12:64098223-64098245 GGTGATGGGGATGGGGAAGGAGG - Intronic
1098331470 12:69358396-69358418 CTTGATGGGGATGGAGGAGGAGG - Intergenic
1099854778 12:88150190-88150212 GCAGAAGGGGAAGCAGGAGCAGG + Intronic
1099857340 12:88183550-88183572 GCTGAGGGAGAAGGAGGAGGCGG + Intronic
1102262718 12:111454434-111454456 GCTGATGGAGCAGGAGGAGGAGG + Intronic
1102681129 12:114691466-114691488 GCTGACGTGGAAGGAGGAGGAGG - Intergenic
1103345265 12:120245070-120245092 GGTGCTGGGGAAGGAGGAGGAGG + Intronic
1103524761 12:121560457-121560479 GCTCAGGCTGATGCAGGAGGTGG + Intronic
1103815928 12:123656201-123656223 ACTGCTGGGGATGAAGGATGGGG + Intronic
1103934278 12:124467169-124467191 GGTGATGAGGATGCAGGTGATGG - Intronic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1104275660 12:127325039-127325061 GATGATGAAGATGGAGGAGGAGG - Intergenic
1104315492 12:127696461-127696483 GCTGATGTGGATGGAGGTGATGG + Intergenic
1104624042 12:130338269-130338291 GGTGCGGGGGATGCAGGAGCCGG + Intronic
1104624154 12:130338605-130338627 GGTGCGGGGGATGCAGGAGCCGG + Intronic
1104624184 12:130338689-130338711 GGTGCGGGGGATGCAGGAGCCGG + Intronic
1104920348 12:132287393-132287415 GCTGGTGGGGATGGTGGCGGCGG - Intronic
1105277386 13:18943931-18943953 GCGGATGTTGATGCAGCAGGTGG - Intergenic
1105413517 13:20191337-20191359 GAATATGGGGCTGCAGGAGGAGG + Intronic
1105915974 13:24916172-24916194 GCTGATGAGGATGGAGAAAGGGG + Intronic
1106006438 13:25774402-25774424 CCTGTTGGGGAGGCAGGGGGAGG + Intronic
1106375500 13:29182912-29182934 GCTGAAGGGGAGGGAGCAGGGGG + Intronic
1107343411 13:39434048-39434070 GTAGATGTGGTTGCAGGAGGTGG - Intronic
1107348099 13:39484775-39484797 GCGGAGGGGGATGAATGAGGAGG + Intronic
1108174718 13:47780396-47780418 GGTGATGATGATGCAAGAGGAGG - Intergenic
1108468273 13:50741001-50741023 TTTGATGGGGAAGCAGGTGGTGG - Intronic
1108521712 13:51252128-51252150 GCTGATGGGGCTGCAAGGGTTGG - Exonic
1110060152 13:71030343-71030365 GCTGAGGGAGAAGGAGGAGGTGG + Intergenic
1110475006 13:75903353-75903375 ACTGATGGGGAAGCAGAAGGAGG + Intergenic
1110767143 13:79293518-79293540 TCTGCTATGGATGCAGGAGGTGG - Intergenic
1112629659 13:101147164-101147186 ACTGGTGGGGATGCAGGCAGTGG - Intronic
1113616741 13:111685654-111685676 GCTGGTGGGAGTGCAGGTGGAGG - Intergenic
1113622271 13:111770925-111770947 GCTGGTGGGAGTGCAGGTGGAGG - Intergenic
1114150724 14:20036002-20036024 ACTGATGGGGATACAGGAAAAGG - Intergenic
1114559295 14:23578886-23578908 GAAGATGGGGAGGCAGGGGGAGG + Intergenic
1114559422 14:23579458-23579480 GGTGGTGGGGATGGAGGATGGGG - Intergenic
1114781415 14:25542322-25542344 TCTGATGGAGGTGCTGGAGGAGG - Intergenic
1117322032 14:54633589-54633611 GGTAGTGGGGATGGAGGAGGTGG + Intronic
1117739948 14:58806837-58806859 GGTCATGGGGATGGTGGAGGTGG + Intergenic
1118009352 14:61593665-61593687 GCTTCTGGGGATACAGCAGGAGG + Intronic
1118568790 14:67172251-67172273 GCTGAGGGGGATGCGGCGGGCGG - Intronic
1118774534 14:68965532-68965554 GGGGGTGGGGATGCTGGAGGTGG - Intronic
1119003943 14:70907684-70907706 GCTGGTGCTGCTGCAGGAGGAGG - Exonic
1119119814 14:72064224-72064246 GCTGAAGGAGGTGAAGGAGGAGG + Intronic
1119309411 14:73633894-73633916 GCTGAAGAGGAGGGAGGAGGGGG - Intergenic
1119851136 14:77867399-77867421 GCTGCTGGGAAGGCAGGATGAGG - Intronic
1119945489 14:78689241-78689263 GAAGATGGTGATGAAGGAGGAGG - Intronic
1120457834 14:84754870-84754892 GGTTATGATGATGCAGGAGGTGG - Intergenic
1120733357 14:88027054-88027076 GCTGATGGTGAGGGAGGAAGTGG + Intergenic
1121472323 14:94165317-94165339 GCTGATGGGGAGGCTAGTGGCGG + Intronic
1122262410 14:100530929-100530951 GCAGTGGGGGACGCAGGAGGAGG + Intergenic
1122281041 14:100622552-100622574 GCTGGTGGGCCTGCAGCAGGAGG - Intergenic
1122518778 14:102327675-102327697 TCTGATGGGGATTCAGGCGAAGG + Intronic
1122801316 14:104231031-104231053 CCTGGTGGGGATGTTGGAGGAGG + Intergenic
1122831537 14:104399703-104399725 GGGGGTGGGGATGCTGGAGGTGG + Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123762189 15:23441637-23441659 GGAGATGTGGAGGCAGGAGGAGG - Exonic
1124011192 15:25840048-25840070 GGGGTTAGGGATGCAGGAGGGGG - Intronic
1124158492 15:27249136-27249158 GGTGATGCGGCTGCGGGAGGTGG + Intronic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124333958 15:28843395-28843417 GAAGATGTGGAGGCAGGAGGAGG - Intergenic
1124394348 15:29288374-29288396 GATGATGGGGAAACAGGAGCAGG - Intronic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125028231 15:35051880-35051902 GCTGAGGCTGAGGCAGGAGGTGG - Intergenic
1127496773 15:59520235-59520257 GTTGGTGGGAATGCAGGATGGGG - Intronic
1128320997 15:66694206-66694228 GCTGTTGAAGATGAAGGAGGGGG - Intergenic
1128938259 15:71766564-71766586 GTAGATGGGAATGAAGGAGGTGG + Intronic
1129184209 15:73895953-73895975 GGTGATAGGGATGATGGAGGTGG + Intergenic
1129245716 15:74277584-74277606 GCTGATGTGTGTGCAGGATGGGG - Intronic
1129406399 15:75321835-75321857 GAGGATGAGGATGAAGGAGGAGG - Intergenic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129503511 15:76061442-76061464 GCACATGGGGATACTGGAGGTGG + Intronic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129655715 15:77524561-77524583 TCAGATGGGGAGGAAGGAGGGGG - Intergenic
1130225767 15:82057390-82057412 GCTTATGGAAATGCAGGAGGTGG + Intergenic
1130430440 15:83842035-83842057 GGGGATGGGGAGGCAGAAGGGGG - Intronic
1131866690 15:96718570-96718592 CCTCTTGGGGATGCAGGGGGAGG - Intergenic
1131901704 15:97094891-97094913 GCTGATGAAGATGCAGGGGCGGG + Intergenic
1132109504 15:99092162-99092184 GCAGATGGGGATGAATGGGGTGG + Intergenic
1132540008 16:504267-504289 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540023 16:504308-504330 GGAGATGGGAGTGCAGGAGGAGG - Intronic
1132540045 16:504382-504404 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540074 16:504477-504499 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540088 16:504518-504540 GGAGATGGGAGTGCAGGAGGAGG - Intronic
1132540110 16:504592-504614 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540128 16:504652-504674 GGTAAGGGGGGTGCAGGAGGAGG - Intronic
1132540166 16:504771-504793 GGAGATGGGGGTGCAGGAGGAGG - Intronic
1132540227 16:504973-504995 GGTGGTGGGGATGCAAGAGGAGG - Intronic
1132669210 16:1095839-1095861 GCTCATGGGGAGGCAGGCAGAGG - Intronic
1132689196 16:1174950-1174972 GCTGGTGGGGGTGGAGGTGGGGG - Intronic
1132847929 16:2009311-2009333 GCCGAGCGGGTTGCAGGAGGGGG - Intronic
1132887099 16:2187069-2187091 GCCTCTGGGGATACAGGAGGGGG + Exonic
1133067455 16:3219245-3219267 GCTGCTGGGAATGCAGGCGCCGG + Intergenic
1133129696 16:3669098-3669120 GGTGATGGGGATGGACAAGGTGG + Intronic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133238861 16:4403061-4403083 CCTGATGGGGATGGGGGTGGGGG - Intronic
1133316168 16:4885387-4885409 GCTCAGGGAGAAGCAGGAGGAGG - Exonic
1133810040 16:9154656-9154678 TCTGCTTGTGATGCAGGAGGAGG + Intergenic
1134192440 16:12132549-12132571 GCTGAAGGGGCTGAATGAGGAGG + Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1135346693 16:21694727-21694749 GCAGATGGGGCTGGAGGATGGGG + Intronic
1135664853 16:24327013-24327035 GGTGATGGGGATGAAGGAGGTGG + Intronic
1136024631 16:27461701-27461723 GCAGATGGGGATGTACCAGGAGG + Intronic
1136377111 16:29872226-29872248 GGTGATGGGGCTGTAGGAGTGGG + Exonic
1136621375 16:31430931-31430953 GCTGTTGGTGGTGAAGGAGGTGG + Intergenic
1136671719 16:31864593-31864615 GCTGCTGCTGCTGCAGGAGGAGG - Intergenic
1137778300 16:51075009-51075031 GCAGATGGGGATGCTTGAGGTGG - Intergenic
1138520560 16:57568676-57568698 GGTGATGGAGGTGGAGGAGGTGG - Intronic
1138520592 16:57568817-57568839 GGTGATGGAGGTGGAGGAGGTGG - Intronic
1138520616 16:57568916-57568938 GATGATGGTGATGACGGAGGTGG - Intronic
1138520686 16:57569252-57569274 GGTGATGGAGGTGGAGGAGGTGG - Intronic
1138520700 16:57569312-57569334 GGTGATGGAGATGATGGAGGTGG - Intronic
1138520712 16:57569363-57569385 GTTGATGGAGGTGGAGGAGGTGG - Intronic
1138520787 16:57569771-57569793 GGTGATGGTGATGATGGAGGTGG - Intronic
1138520812 16:57569924-57569946 GCTGATGGAGGTGGAGGAGATGG - Intronic
1138568601 16:57852361-57852383 GCTGATGATGAGGCAGGAGGTGG - Intronic
1138598337 16:58041264-58041286 GTTGCTGGGGATGCAGCAAGGGG - Intronic
1138706936 16:58924792-58924814 GCTGTTGGGGAGGCAGAAGTGGG - Intergenic
1139343551 16:66287700-66287722 GCCGAGGGGGATGCAGGGGCAGG - Intergenic
1139475008 16:67198720-67198742 GGTTATGGGGCAGCAGGAGGTGG - Exonic
1139658564 16:68404541-68404563 GAGGGTGGGTATGCAGGAGGTGG + Intronic
1140479278 16:75253724-75253746 GTTGATGGGGATGTAGCTGGGGG + Intronic
1141589958 16:85061826-85061848 GCGGAAGGGGTTGCAGCAGGAGG + Intronic
1141845294 16:86604269-86604291 GCAGAAGGTGAAGCAGGAGGAGG - Intergenic
1141943213 16:87292387-87292409 GCTGATGGTGATGTAGCAGCTGG + Intronic
1142255796 16:89013299-89013321 GGAGCTGGGGCTGCAGGAGGCGG + Intergenic
1142372608 16:89691434-89691456 GCTGATGGGGATGCCTGGGGAGG - Exonic
1142535447 17:614560-614582 GCTGAAGGGAGTGCATGAGGCGG + Intronic
1142934414 17:3316061-3316083 GTTGATGGTGGTGCAGGATGAGG - Intergenic
1142980054 17:3666484-3666506 TCAGATGGGGACCCAGGAGGAGG + Intronic
1143100852 17:4503927-4503949 GCTGAGCTGGGTGCAGGAGGAGG + Intronic
1143140866 17:4741047-4741069 GCTGCCCGGGAGGCAGGAGGTGG + Exonic
1143188102 17:5022598-5022620 GCTGACGGGGATTCTGCAGGAGG + Exonic
1143338876 17:6193987-6194009 GGTGATGGTGATGGAGGTGGTGG + Intergenic
1143338905 17:6194092-6194114 GGTGATGGTGATGGAGGTGGTGG + Intergenic
1143500636 17:7336670-7336692 GCCCCTGGGGATGCAGGTGGAGG - Exonic
1143572192 17:7766382-7766404 GCTGATGGCCATGCGGGAAGAGG + Exonic
1143649568 17:8255137-8255159 GGTGATGGGGAATCAGGAGGAGG + Intronic
1143773579 17:9183323-9183345 GATGCTGGGGATACAGAAGGAGG + Intronic
1143875659 17:9988789-9988811 GCTGAAGGGGATGCCAGATGTGG - Intronic
1143978302 17:10846454-10846476 GTTGATGGAGATGAAGGTGGTGG + Intergenic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1144586287 17:16489859-16489881 GCTGATGGGGGGGTGGGAGGGGG - Intronic
1144833291 17:18143601-18143623 GCTGCTGTGGGAGCAGGAGGTGG + Exonic
1145973006 17:28967956-28967978 AATGCTGAGGATGCAGGAGGGGG + Intronic
1146399465 17:32491883-32491905 GGTTATGGGGATGCTGGATGTGG + Intergenic
1146660664 17:34663311-34663333 GCAGATGGGGCAGGAGGAGGAGG + Intergenic
1147416867 17:40298252-40298274 ACTGATGGGGAAAAAGGAGGAGG - Intronic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147521535 17:41177970-41177992 GCAGCTGGGGCTGCAGCAGGTGG + Exonic
1147597685 17:41727369-41727391 GCTGATTGAGATGCAGGAGGAGG - Intronic
1147647667 17:42043470-42043492 GTTGATGGGGAGGCAGGCTGGGG + Intronic
1147663713 17:42131682-42131704 GCTGTTGGGGATGCAGGACTTGG - Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1148070567 17:44906360-44906382 GCTGGTAGAGATGGAGGAGGAGG - Intronic
1148082417 17:44974865-44974887 GGGGATGGGGATGGAGTAGGGGG + Intergenic
1148083830 17:44982319-44982341 GGTGGTGGTGATGGAGGAGGTGG + Intergenic
1149519773 17:57309963-57309985 GATGATGGGGGTGCAGGGGCTGG + Intronic
1150107374 17:62472356-62472378 CCTGCTGGGCATGGAGGAGGAGG - Intronic
1150128525 17:62653733-62653755 GCTGTTGGGGAGGAGGGAGGAGG + Intronic
1150238311 17:63611150-63611172 GCAGCTGTGGGTGCAGGAGGTGG - Intergenic
1150427153 17:65086055-65086077 GCAGATGGGGGAGCAGGAGCCGG - Intergenic
1150999026 17:70352141-70352163 GCGGATGGGGAGCCAGAAGGGGG - Intergenic
1151352037 17:73537510-73537532 GCTGATGGAGAGGCAGGCAGAGG + Intronic
1151439665 17:74120026-74120048 GCTGAGGGGGCTCCAGGTGGAGG + Intergenic
1151657126 17:75501375-75501397 GATCATGGGGATGTTGGAGGGGG - Intronic
1151935215 17:77257159-77257181 GGTGATGGGGATGAAGGAAGTGG - Intergenic
1151935240 17:77257254-77257276 GGTGATGGGGATGAAGGAGATGG - Intergenic
1151935278 17:77257404-77257426 GGTGATGGAGATGAAGGAGGTGG - Intergenic
1151935297 17:77257477-77257499 GGTGATGGGGATGGAGGAGGTGG - Intergenic
1151976126 17:77484367-77484389 GGTGATGGGGATGGTGGTGGTGG + Intronic
1152033915 17:77860041-77860063 GGGGATGGGGAAGCAGGAGCTGG + Intergenic
1152095066 17:78267927-78267949 TCTGGTGGGGGTGAAGGAGGAGG + Intergenic
1152499861 17:80700663-80700685 GGTGATGGTGATGATGGAGGTGG + Intronic
1152652318 17:81500408-81500430 GCCGATGGGAATGCAAGATGAGG + Intergenic
1152659334 17:81535228-81535250 GGGGATGGGGATGATGGAGGAGG - Intronic
1152698264 17:81806855-81806877 GATGGTGGAGATGCAGGCGGGGG - Intronic
1152820632 17:82436000-82436022 CGTCAAGGGGATGCAGGAGGTGG - Intronic
1153429341 18:4999078-4999100 GCTGCTGGGGATGAAGGAGGGGG - Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154503061 18:15005946-15005968 GCTGAGGGGCACGCAGGTGGGGG + Intergenic
1155504711 18:26521830-26521852 GCTGCTGGGGAAGGAGCAGGAGG + Intronic
1156228608 18:35132757-35132779 GCTGATGGAGACCCAGGATGTGG + Intronic
1157284803 18:46370433-46370455 GCTGAGGTGGATGGAGGAGGGGG + Intronic
1157298442 18:46462418-46462440 GCTGATGTGGAGGGAGGAAGTGG + Exonic
1157764376 18:50285916-50285938 GCTGCTGGTGATGCTGCAGGAGG + Exonic
1157764379 18:50285919-50285941 GCTGGTGATGCTGCAGGAGGGGG + Exonic
1158911247 18:62065055-62065077 GCTGATACTGATGCAGGAAGGGG + Intronic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160971352 19:1769120-1769142 GGTGATGGAGATGGAGGTGGAGG + Intronic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161093460 19:2375350-2375372 ACTGATGGGGATGGAGGGGTGGG + Intergenic
1161093475 19:2375412-2375434 ACTGATGGGGATGGAGGGGTAGG + Intergenic
1161093509 19:2375537-2375559 ACTGATGGGGATGGAGGGGTGGG + Intergenic
1161689140 19:5720740-5720762 GCTGATGTTGATGCTGGTGGCGG + Exonic
1161996933 19:7718884-7718906 GCTGATGGGGGTGCAGGAAGTGG - Intergenic
1162283595 19:9720372-9720394 GGAGAAGGGGGTGCAGGAGGTGG - Intergenic
1162526867 19:11211295-11211317 GGTGATGGAGATGGGGGAGGTGG - Intronic
1162535487 19:11261318-11261340 GCTGCTTGAGATGCGGGAGGTGG - Intronic
1163014179 19:14443561-14443583 GCTGAAGGTGAAGCAGGGGGCGG + Exonic
1163144731 19:15372919-15372941 CGTGATGGGCATGCAGGGGGCGG - Exonic
1163263159 19:16203524-16203546 CCTGATGGAGAAGGAGGAGGAGG + Exonic
1163311807 19:16519393-16519415 GCAGATGGGGGTGCACGTGGGGG + Intronic
1163489190 19:17606884-17606906 GGTGAGGGGCATGCGGGAGGCGG - Intronic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164605512 19:29595195-29595217 GCTGCAGGGGAAGAAGGAGGAGG + Intergenic
1164721959 19:30438997-30439019 GCTCATGGGGCTGGAGGAAGTGG - Intronic
1165099113 19:33428087-33428109 GCTCCTGGCTATGCAGGAGGGGG - Intronic
1165126441 19:33601102-33601124 TCTCATGGGGATGCAGGTGATGG + Intergenic
1165148825 19:33749415-33749437 GATGATGGGGAGGATGGAGGGGG - Intronic
1165447114 19:35862439-35862461 GCTGAGGGGGAACCAGGAAGCGG - Intronic
1165746060 19:38229876-38229898 GCTGCTGGGGATACAGGGAGGGG + Intergenic
1165798493 19:38533020-38533042 GATGATGGGGATACAGGCAGAGG + Intronic
1165886318 19:39081547-39081569 GCTGGAGAGGAAGCAGGAGGGGG + Intergenic
1166269152 19:41703152-41703174 GGTGATGGGGACACAGGTGGAGG - Intronic
1166427511 19:42692690-42692712 GATCATGGGGCTGCAGGTGGAGG + Intronic
1166432830 19:42741337-42741359 GCTCATTGAGATGCAGGAGGGGG + Intronic
1166445814 19:42856592-42856614 GCTCATTGAGACGCAGGAGGGGG + Intronic
1166448799 19:42880552-42880574 GCTCATTGAGATGCGGGAGGGGG + Intronic
1166492381 19:43270398-43270420 GCTCATTGAGACGCAGGAGGGGG + Intergenic
1167620163 19:50556153-50556175 GCTGATGAGGAAGCAGGACTAGG + Intronic
1168259923 19:55187600-55187622 GTTGCTGGGGATGCAGGGAGAGG + Exonic
1168287379 19:55341356-55341378 GCTGCCGGGGAGGCAGGGGGCGG + Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
925230110 2:2225659-2225681 GCTCATGGAGGAGCAGGAGGAGG - Intronic
925428796 2:3773378-3773400 GCTGATGGAGATGGTGGGGGAGG - Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
925616265 2:5747161-5747183 GCTGATGTGGAGGATGGAGGAGG - Intergenic
926098953 2:10101549-10101571 AGTGCTGGGGATGCAGGTGGAGG + Intergenic
926280523 2:11442335-11442357 GGTGATGTTGATGCAAGAGGTGG + Intergenic
927250445 2:20991325-20991347 CCTTAAGGGGATACAGGAGGTGG - Intergenic
927645143 2:24872783-24872805 GGAGAAGGGGATGGAGGAGGTGG + Intronic
927919910 2:26964260-26964282 GCAGATGGAGATGCAGAAGCTGG + Intergenic
928173399 2:29017900-29017922 GCTGATGGGGATGCTGGGCAGGG - Exonic
928657542 2:33468197-33468219 GCTGATGAGCATAAAGGAGGAGG + Intronic
929520515 2:42646246-42646268 TCTGATGGGGATGTACAAGGAGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930050853 2:47215298-47215320 ACTAATGGGGATGAAGGATGGGG + Intergenic
930741307 2:54835417-54835439 AGTGATGAGGATGCAGAAGGAGG + Intronic
931246061 2:60493845-60493867 GCTGATGAGGATGGGGGAGGGGG - Intronic
931671716 2:64653828-64653850 GCGGAGGAGGAAGCAGGAGGCGG + Exonic
932238172 2:70137731-70137753 GTAGATGGAGATGCAGGAGATGG - Intergenic
932434933 2:71697553-71697575 GGGGATGGGGATGCGGGTGGGGG + Intergenic
932485165 2:72080378-72080400 GCTGAAGGGGGTGCATGGGGAGG + Intergenic
933481377 2:82861236-82861258 GATGATGAGGAAGAAGGAGGAGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934660237 2:96139299-96139321 GCTCAGGGGTATGGAGGAGGGGG - Intergenic
934922972 2:98360363-98360385 GCTGAGGGGGCTGAAGGAAGGGG + Intronic
935349513 2:102141703-102141725 TCTGAAAGGGATGCAGGAAGGGG + Intronic
935958764 2:108403383-108403405 GGAGAAGGGGGTGCAGGAGGTGG - Intergenic
936294030 2:111251544-111251566 GGTGATGGTGATGGTGGAGGTGG - Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
936622390 2:114113809-114113831 ACTGAGGGGGCTGCAGGAAGAGG + Intergenic
937273350 2:120669316-120669338 GCTGGGGGAGAAGCAGGAGGCGG + Intergenic
937365348 2:121257265-121257287 GCTGTAGGGGAGGCAGGAGGGGG - Intronic
937818077 2:126275641-126275663 GAGGATGGTGATGCAGGACGTGG - Intergenic
937869276 2:126776326-126776348 GCAGAGAAGGATGCAGGAGGAGG + Intergenic
938036801 2:128041432-128041454 GGAGAAGGGGGTGCAGGAGGTGG - Intergenic
938065362 2:128279167-128279189 GCTGATGGGGGTGCGGGGGTGGG + Intronic
938097646 2:128474075-128474097 GCTGAGGGGGCTGGAGGACGGGG - Intergenic
938373027 2:130785673-130785695 ACAGATGGCGATGGAGGAGGAGG - Intergenic
938502226 2:131836116-131836138 GCTGAGGGGCACGCAGGTGGGGG + Intergenic
939480622 2:142743079-142743101 GCTGATGGGATTGTGGGAGGGGG - Intergenic
939977632 2:148737447-148737469 GCTGAGGGGGTTGCTGGAGATGG + Intronic
940506484 2:154560831-154560853 GGTGATGGGGATGCAGACAGGGG - Intergenic
941349416 2:164413966-164413988 GGTGATGCTGATGCAAGAGGTGG + Intergenic
942642220 2:178072335-178072357 GCGGAAGGGGAAGCAGGAGATGG - Exonic
942792806 2:179779999-179780021 GCTGCTGGGGTTGGAGGAGAGGG + Intronic
943575409 2:189625835-189625857 CCTGATGAGGCTCCAGGAGGTGG - Intergenic
943724297 2:191237149-191237171 GCTGATAGAGATGGGGGAGGGGG - Intergenic
944888026 2:204085041-204085063 GCAGATGGAGATGCTGGAAGAGG + Intergenic
945175741 2:207041528-207041550 ACTGATGAGGATGGGGGAGGGGG - Intergenic
945424273 2:209680773-209680795 GGTGATGGGGGTGGAGAAGGAGG - Exonic
946202117 2:218076480-218076502 GCTGCTGAGGGAGCAGGAGGGGG + Exonic
946395706 2:219442706-219442728 GAAGATGGGGATGCGGGGGGCGG - Intronic
946412408 2:219521937-219521959 GAGGATGGGAAGGCAGGAGGAGG + Intronic
947831357 2:233144042-233144064 GGTGATGGCGATGGTGGAGGTGG + Intronic
947831378 2:233144160-233144182 GGTGATGGTGATGTTGGAGGTGG + Intronic
947831393 2:233144229-233144251 GGTGATGGTGATGGTGGAGGTGG + Intronic
947831477 2:233144607-233144629 GGTGATGGTGATGGTGGAGGTGG + Intronic
948244246 2:236464882-236464904 GCAGAAGGTGATGCAGGAGAAGG - Intronic
948493267 2:238327495-238327517 GCTGTCGGGGATGCTGGAGAAGG + Intronic
948530718 2:238601759-238601781 GCTGCTGGGGGTGCAGCAAGAGG - Intergenic
948725998 2:239934351-239934373 GGGGGTGGGGAGGCAGGAGGTGG - Intronic
948777007 2:240294420-240294442 GCAGTTGGGGAGGCAGGAGGAGG - Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
948910512 2:241000086-241000108 GGTGGTGGGGTTGAAGGAGGTGG - Intronic
1168757554 20:327102-327124 GCTGGTGGCTGTGCAGGAGGGGG - Exonic
1170040679 20:12036299-12036321 GCTGATGGGAATGGAGGTGGGGG - Intergenic
1170559509 20:17544701-17544723 GGTGATGGATATTCAGGAGGTGG - Intronic
1170965597 20:21068043-21068065 GCTGAGGAGGATGCTGGTGGTGG - Intergenic
1171413265 20:24960475-24960497 TCTGTTGGGGGTGCACGAGGAGG + Intergenic
1172097384 20:32467073-32467095 GCTGATGGGGAAGGAGCTGGTGG - Intronic
1172110886 20:32544285-32544307 GATGATGGGAAGGCAGGGGGCGG + Intronic
1172603317 20:36198158-36198180 GCTGGTGGGGATGGAGAGGGTGG + Intronic
1172622897 20:36331334-36331356 GCAGCTGGGGATGCCGGAGATGG - Intronic
1172630108 20:36372429-36372451 GGTGATGGGGAGGGAGGTGGTGG - Intronic
1172773196 20:37393231-37393253 GCAGATGGGTAGGCTGGAGGAGG + Intronic
1172792714 20:37517249-37517271 GATGGTGGGGATGGGGGAGGGGG - Intronic
1172872939 20:38147091-38147113 GGAGATGGGGAAGAAGGAGGTGG + Intronic
1173616902 20:44409120-44409142 GCTGATCCCGATGCAGGAGTGGG + Intronic
1173954366 20:47019188-47019210 GCTGGTGGGGATTGAGGTGGGGG - Intronic
1174495402 20:50938082-50938104 GTGGATGGGGAGGAAGGAGGTGG - Intronic
1174774367 20:53330648-53330670 GATGATGGGGATGCAGAAGAAGG - Intronic
1175147053 20:56904847-56904869 GCTGGTGGGGGTGGAGGGGGTGG + Intergenic
1175169420 20:57069878-57069900 GCTGGTGGAGATGCAGGTGGAGG - Intergenic
1175381759 20:58568603-58568625 GCTGGTGCTGCTGCAGGAGGGGG + Intergenic
1175491517 20:59383825-59383847 GATGATTGGGGTGGAGGAGGAGG + Intergenic
1175852788 20:62102797-62102819 GCAGAAGGGGAAGCAGGAGCAGG - Intergenic
1175862021 20:62155666-62155688 GGAGATGGGGTTGGAGGAGGGGG - Intronic
1175942947 20:62546286-62546308 GCTGTGGCGGGTGCAGGAGGAGG + Intergenic
1175989243 20:62779299-62779321 GCTGTGGGGGCTGCAGGGGGTGG - Intergenic
1176019795 20:62956824-62956846 GCAGATGGGCATGCTGGAGCGGG - Exonic
1176107407 20:63395886-63395908 GCGGCCGGGGCTGCAGGAGGAGG + Intergenic
1177238792 21:18429033-18429055 ACTGATGCTGATGCAAGAGGTGG - Intronic
1177684472 21:24418670-24418692 GGTCATGCTGATGCAGGAGGTGG + Intergenic
1179032307 21:37731299-37731321 GATGCTGGGGATGGAGGAGAAGG + Intronic
1179150756 21:38806231-38806253 GCTGCCGGGGGTGCAGGTGGGGG + Intronic
1179251222 21:39673360-39673382 GCTGGTGGGGAGGGAGCAGGAGG - Intergenic
1179284467 21:39965333-39965355 GCTGGTGGGGGTGCAGGGTGTGG - Intergenic
1179435677 21:41360576-41360598 GGTGAGGGGCGTGCAGGAGGGGG + Intergenic
1179586361 21:42376256-42376278 GGTGGTGGGGAGGCAGGTGGCGG - Intronic
1179709542 21:43205325-43205347 GCTGAAGGGGATGGTGGAGGAGG + Intergenic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1180701352 22:17783038-17783060 GCTGATGGAGAAGCGGGGGGGGG + Intergenic
1180971670 22:19819230-19819252 GCTGCTGGGTAAGCAGGAGGTGG - Intronic
1181308210 22:21928872-21928894 TCTAATGGGGGAGCAGGAGGAGG - Intronic
1181646502 22:24234040-24234062 CCTGGTGGGGAGGCAGGGGGAGG - Intronic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1181986560 22:26803961-26803983 ACTGATGGGGATGCCCCAGGAGG + Intergenic
1182415858 22:30221123-30221145 GCAGACGGGGAATCAGGAGGAGG + Intergenic
1183142978 22:35961683-35961705 GCCAATAGGGAAGCAGGAGGAGG - Intronic
1183655588 22:39182841-39182863 GTTGCTGGAGATGCAGGAAGAGG + Intergenic
1183847442 22:40553926-40553948 GGTCATGTTGATGCAGGAGGTGG - Intronic
1184137929 22:42560386-42560408 GATGAGGGTGAGGCAGGAGGGGG - Intronic
1184243088 22:43221563-43221585 GCTGATGGGGAGGAGGTAGGAGG - Intronic
1184289625 22:43491624-43491646 GGTGATGGTGATGGAGGTGGTGG + Intronic
1184289634 22:43491660-43491682 GGTGATGGTGATGGAGGTGGTGG + Intronic
1184291410 22:43499745-43499767 GGTGATGGTGATGGAGGTGGCGG + Intronic
1184291433 22:43499823-43499845 GGTGATGGTGATGGAGGTGGTGG + Intronic
1184291456 22:43499901-43499923 GGTGATGGTGATGGAGGTGGTGG + Intronic
1184291480 22:43499982-43500004 GGTGATGGTGATGGAGGTGGCGG + Intronic
1184291504 22:43500060-43500082 GGTGATGGTGATGGAGGTGGTGG + Intronic
1184291532 22:43500159-43500181 GGTGATGGTGATGGAGGTGGTGG + Intronic
1184291557 22:43500258-43500280 GGTGATGGTGATGGAGGTGGCGG + Intronic
1184352323 22:43952346-43952368 GCTGGTGGGACTGCAGGAGCTGG - Intronic
1184455430 22:44607274-44607296 GAGGATGGGGATGGAGGAGGAGG + Intergenic
1184538741 22:45105805-45105827 GCTGGAGTGGAGGCAGGAGGAGG + Intergenic
1184639822 22:45864643-45864665 GGGGATGAGGAAGCAGGAGGCGG - Intergenic
1184654846 22:45935867-45935889 GGTGATGGGGAAGCTGGATGAGG + Intronic
1184713193 22:46265216-46265238 GCTCATGCTGATGCAAGAGGTGG + Intergenic
1184750233 22:46481706-46481728 GCAGCTGCGGGTGCAGGAGGTGG - Intronic
1185009431 22:48304992-48305014 CCTGACGGAGATGCAGCAGGGGG + Intergenic
1185199381 22:49492210-49492232 GCAGCTGGGGAGGTAGGAGGAGG - Intronic
1185227533 22:49661395-49661417 GCTGTGGGGGCTGCAGGAGCTGG - Intergenic
1185408741 22:50672155-50672177 GCTGGTGGGTTGGCAGGAGGCGG + Intergenic
949184050 3:1169046-1169068 ACTGATGGGGATGCAGTGAGTGG + Intronic
949261358 3:2106074-2106096 GGTCATGCTGATGCAGGAGGTGG + Intronic
949590349 3:5487634-5487656 GCTTATGGGGTGGCAGTAGGGGG + Intergenic
949960940 3:9311787-9311809 GATGCTGGGGTTGGAGGAGGTGG + Intronic
950234274 3:11305004-11305026 GCTGGTGAGTATGGAGGAGGGGG - Intronic
950290454 3:11779858-11779880 TCAGCTGGGGATCCAGGAGGAGG - Intergenic
950764184 3:15261105-15261127 TCTGCAGGGGAGGCAGGAGGTGG - Intronic
951484981 3:23201641-23201663 GGTGTTGGGGAGGGAGGAGGCGG + Intergenic
951529690 3:23686813-23686835 GCTGAGGGGAAAGCAGGAGGTGG - Intergenic
952441911 3:33339281-33339303 GCTGATGAGGATGCAGAGAGAGG + Intronic
953550607 3:43899515-43899537 GCAGGTAGGGAAGCAGGAGGTGG - Intergenic
954388050 3:50254720-50254742 GATGATGGAGAAGCAGGAGGTGG - Intronic
954398006 3:50303231-50303253 GCTCATGGGGAAGCAGGGGTGGG - Exonic
954408380 3:50358251-50358273 GCTGATGGTGATGGAGGATGGGG + Exonic
954820077 3:53318430-53318452 ACAGATGGGGATGGTGGAGGGGG + Intronic
955136327 3:56222427-56222449 GATGATGGGGGAGCAGGAGGTGG - Intronic
955320946 3:57973807-57973829 GCTCCTTGGGATGCAGGGGGTGG + Intergenic
955751661 3:62189951-62189973 GCTTATGGAGATGAAGGGGGTGG - Intronic
956667953 3:71659756-71659778 CCTGATGGAGAAGCAGGATGTGG - Intergenic
957276157 3:78093652-78093674 GATCATGCTGATGCAGGAGGTGG - Intergenic
957557464 3:81780451-81780473 GGTCATGGTGATGCAAGAGGTGG + Intergenic
959032873 3:101322381-101322403 GGTGTGGGGGAAGCAGGAGGCGG + Intergenic
959502067 3:107118183-107118205 GCTAATGGGGAAGCAGCAGTTGG - Intergenic
959827442 3:110815298-110815320 GCTGAAAGGGAAGAAGGAGGTGG - Intergenic
960121857 3:113955190-113955212 TCAGAAGGGGATGCAGGAGAGGG + Intronic
960225003 3:115158282-115158304 GATGATGCTGATGCAAGAGGTGG - Intergenic
960948386 3:122982611-122982633 GTTGGTGGGGAAACAGGAGGAGG - Intronic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961108432 3:124262076-124262098 GCTGGTGAGGATACAGGAAGGGG + Intronic
961143114 3:124572210-124572232 GCTGCTGGGGGTGGAGGTGGGGG + Intronic
961387333 3:126530008-126530030 GATGATGGGGGTGGAGGGGGTGG + Intronic
961428007 3:126862358-126862380 GGTGATGGTGGTGGAGGAGGTGG - Intronic
961428327 3:126863462-126863484 GGTGATGGTGGTGGAGGAGGTGG - Intronic
961428411 3:126863765-126863787 GCTGATGGTGGTGGAGGAGGAGG - Intronic
961428543 3:126864277-126864299 GGTGGTGGTGATGGAGGAGGAGG - Intronic
961428589 3:126864465-126864487 GCTGGTGGTGATGGAGGAGGAGG - Intronic
961656550 3:128445603-128445625 GCTGCTGGTGGTGCTGGAGGTGG + Intergenic
961924250 3:130460618-130460640 GGTGATGGTGATGGAGGCGGTGG + Intronic
962022926 3:131518733-131518755 GCTGATGTGGGTCCAGTAGGAGG + Intergenic
962151801 3:132901860-132901882 GCTGCTGGGGGTAGAGGAGGGGG - Intergenic
962254478 3:133861020-133861042 GCTGCTGGGGATGGAGGGGGAGG - Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962716213 3:138128410-138128432 GCTGAAGGTGAAGCAGGAGTAGG + Intronic
962754710 3:138458717-138458739 GCTGCTGGGGCTGGTGGAGGTGG - Intronic
963671675 3:148258861-148258883 GCTCATGCTGATGCAAGAGGTGG - Intergenic
963671834 3:148260413-148260435 GCTCATGCTGATGCAAGAGGTGG - Intergenic
964212040 3:154239469-154239491 GCTGATGATGTTTCAGGAGGAGG + Intronic
964522635 3:157584728-157584750 GCTTATGGACAGGCAGGAGGGGG + Intronic
965736790 3:171829152-171829174 TAGGATGGGGAGGCAGGAGGAGG + Intergenic
965835295 3:172844723-172844745 GCAGATGGTGATGCAGTATGTGG + Intergenic
966403002 3:179565589-179565611 GGTAATGGGGATGATGGAGGAGG + Intronic
966625390 3:182010199-182010221 GCTGATGCGGGTGGAAGAGGAGG + Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967597872 3:191349080-191349102 GCTGATGGGGGTGGAGGAGGGGG + Intronic
968234704 3:197024730-197024752 GCTGCTGGGGAAGGAAGAGGGGG - Intronic
968689857 4:1984821-1984843 GGAGCTGGGGATGTAGGAGGAGG + Exonic
968737110 4:2303378-2303400 GCAGATGGGGATGAAGGTGGGGG - Intronic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
968934284 4:3601863-3601885 CCTGATGGGGAAGTGGGAGGGGG - Intergenic
969280936 4:6170436-6170458 GGTGATGGTGATGGAGGTGGTGG - Intronic
969280962 4:6170537-6170559 GGTGATGGTGATGGAGGTGGTGG - Intronic
969281031 4:6170835-6170857 GGTGATGGGGATGGTGGTGGTGG - Intronic
969281055 4:6170937-6170959 GGTGATGGGGATGCTGGTGGTGG - Intronic
969462868 4:7337986-7338008 GGTGATGGGGATGCAACAGTAGG - Intronic
969467546 4:7366544-7366566 GCTGATGAGGATGGAGGAGGGGG - Intronic
969625006 4:8297890-8297912 GCAGGTGGGGCTGCAGGAGCAGG - Intronic
969659030 4:8515628-8515650 CCTGAGGGCCATGCAGGAGGCGG + Intergenic
969660602 4:8525351-8525373 GGTGATGGGGCTCCAGGAGGTGG - Intergenic
969710786 4:8841752-8841774 GGTGATGGTGATGATGGAGGTGG + Intergenic
970157167 4:13153138-13153160 GGTCATGCTGATGCAGGAGGTGG + Intergenic
970445540 4:16120795-16120817 GGTGATGGGGGTGATGGAGGCGG - Intergenic
971394493 4:26215801-26215823 GGTGAGAGGGATGCGGGAGGCGG - Intronic
972680843 4:41305601-41305623 GCTAATGGGGATAGAGCAGGAGG - Intergenic
974472544 4:62337450-62337472 TCTGATGGGGATGGAGGTGTGGG - Intergenic
974589711 4:63929210-63929232 CCTGATGAGGATGCTGAAGGGGG - Intergenic
975411291 4:74054212-74054234 GCAGATGGGGATGGAGGTAGAGG + Intergenic
977060545 4:92253529-92253551 GATGATGCCGATGCAAGAGGTGG + Intergenic
977540910 4:98317502-98317524 GGTGATAGGGTTGGAGGAGGAGG + Intronic
978404479 4:108364728-108364750 GAAGATGGGGAAGCAGGAGGAGG - Intergenic
978788592 4:112637350-112637372 ACTGATGGGTGTGCAGGACGGGG - Intronic
978976688 4:114884282-114884304 GCTGCTGGGGAGGCAGGAAGAGG + Intronic
979546454 4:121945654-121945676 GCAGGTGGGGATGTAGGGGGAGG - Intronic
979665272 4:123304303-123304325 GCTCATGTGGATGCAGGGGGAGG - Intronic
980368670 4:131839109-131839131 GGTCATGCTGATGCAGGAGGTGG - Intergenic
980870130 4:138601669-138601691 TCTGATGGAGATGTAGAAGGAGG + Intergenic
980960701 4:139471392-139471414 GCTGCTCGGGGTGCAGGGGGTGG + Intronic
981741491 4:148006871-148006893 GCTGATGGGGAGGAAGGAAAGGG - Intronic
981861556 4:149362004-149362026 GGTCATGGTGATGCAAGAGGTGG - Intergenic
982067894 4:151670944-151670966 CCTGATGTGGATGAAGCAGGCGG + Exonic
982073163 4:151713497-151713519 GCTGATGGAGTTGCAGCAGCTGG - Intronic
982138119 4:152292129-152292151 GCTTAGGGAGATGCATGAGGTGG + Intergenic
982171606 4:152667114-152667136 GCAGATGGGGTTGCAGGTGCTGG - Intronic
982193012 4:152877291-152877313 GGTCATGCTGATGCAGGAGGTGG - Intronic
982221578 4:153129643-153129665 GGTGATGGTGATGCTGGTGGTGG - Intergenic
982232599 4:153222850-153222872 GCTGCGGGGGAGGAAGGAGGAGG + Intronic
982278678 4:153662629-153662651 GTTGATGGTGATGATGGAGGTGG + Intergenic
982278697 4:153662736-153662758 GTTGATGGTGATGATGGAGGTGG + Intergenic
982278724 4:153662876-153662898 GTTGATGGTGATGATGGAGGTGG + Intergenic
982278731 4:153662912-153662934 GTTGATGGTGATGATGGAGGTGG + Intergenic
982278760 4:153663055-153663077 GGTGATGGTGATGATGGAGGTGG + Intergenic
982388879 4:154842372-154842394 GTTGATGAGGATGCAGAAGTTGG + Intergenic
984695515 4:182775529-182775551 GCAAACGGGGATGCAGGTGGCGG - Intronic
984818187 4:183857644-183857666 GCTGCCCGGGATTCAGGAGGTGG - Intronic
984871543 4:184329857-184329879 GAGGATGGGGATGCGGAAGGGGG - Intergenic
985019177 4:185669488-185669510 GCAGATGTGGAAGCTGGAGGTGG + Intronic
985202925 4:187503130-187503152 GCTAATGTGGGTGCAGAAGGAGG - Intergenic
985505647 5:278795-278817 GGTGCTGGGGATGCAGGGGAGGG + Intronic
985891825 5:2721858-2721880 GCTGAGGGAGAGGGAGGAGGCGG + Intergenic
985900745 5:2788529-2788551 GGCGATGGGGCAGCAGGAGGTGG - Intergenic
985920368 5:2966649-2966671 GCTGATGGGCATGAATGGGGTGG + Intergenic
986283850 5:6345691-6345713 GCAGATGTGGTTTCAGGAGGTGG + Intergenic
986400072 5:7371659-7371681 GCTGGTGGTGATGATGGAGGTGG - Intergenic
986400176 5:7372126-7372148 GCTGATGGTGATGGTGGAGGTGG - Intergenic
986584023 5:9295535-9295557 AGTGATGGGGAAGGAGGAGGAGG + Intronic
988528742 5:32008990-32009012 GTTGGTGGGGAGACAGGAGGAGG + Intronic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
990510442 5:56484590-56484612 ACTAATGGGGAAGCAGGAGGGGG - Intergenic
990671088 5:58130784-58130806 GCTGGTGGGGATGAAGGAGCAGG - Intergenic
990825468 5:59893457-59893479 GGTGATGGGGATGCAGGAGGCGG + Exonic
991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG + Intergenic
991934441 5:71788005-71788027 GCTGATGGAGATGATGGGGGTGG + Intergenic
992062504 5:73068689-73068711 GCTAATGGTGCAGCAGGAGGTGG - Exonic
992073531 5:73170575-73170597 GCTGATTGGAGGGCAGGAGGAGG + Intergenic
992882062 5:81120082-81120104 GCTAAGGGGGATGCATTAGGTGG - Intronic
993481547 5:88430647-88430669 GGTAATGCTGATGCAGGAGGTGG + Intergenic
995393099 5:111660823-111660845 GCTCATGCTGATGCAAGAGGTGG + Intergenic
995523344 5:113031372-113031394 GAGGATGGTGTTGCAGGAGGGGG + Intronic
996098175 5:119420944-119420966 GGTCATGGTGATGCAAGAGGTGG - Intergenic
996556921 5:124787854-124787876 GCTACTGGGGATGCTGGAGGAGG - Intergenic
996811864 5:127524698-127524720 GTTGATGGAGAAACAGGAGGTGG - Exonic
997013373 5:129904520-129904542 GCTGGAGGAGCTGCAGGAGGAGG - Exonic
997391520 5:133520875-133520897 GCTGATGTGGAGGAAGAAGGTGG + Intronic
997889189 5:137660003-137660025 GCTGATGGTGGTGGAGGAGGAGG - Intronic
998156513 5:139789852-139789874 GGAGATGTGGATGAAGGAGGGGG + Intergenic
998372984 5:141672925-141672947 GCTGGTGGGGATGGAGAAGCAGG + Exonic
999187627 5:149724447-149724469 GCTGAGGAGGATGAAGGAGGAGG + Intergenic
999249211 5:150172065-150172087 GCTGGTGAAGATGCAGGAGAGGG - Intronic
999264177 5:150255728-150255750 GCTGCTGAGGAAGCAGGAGCTGG + Intronic
999282599 5:150375073-150375095 CCAGGTGGGGAAGCAGGAGGAGG + Exonic
999320806 5:150613948-150613970 GATGATGGGGAATCAGAAGGAGG + Intronic
999353210 5:150897611-150897633 GCTGATGAGGCTGAAGGAGGAGG - Intronic
999804825 5:155071777-155071799 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1000330189 5:160199678-160199700 GCTAATGGAGACGAAGGAGGGGG - Intronic
1001307545 5:170586374-170586396 GCTGATGGGGATGCAGAGGAGGG + Intronic
1001318916 5:170664180-170664202 GTGGATGGGGGTGCAGGAAGAGG - Intronic
1001521255 5:172395139-172395161 GGTGGTGGGGATGCATGGGGAGG - Intronic
1001628711 5:173158577-173158599 GTTGCTGGGGAACCAGGAGGCGG + Intronic
1001711765 5:173784547-173784569 GGTGATGGGGATGAAGAAGAGGG - Intergenic
1002068569 5:176664996-176665018 GCTAATGGGGATGAATGGGGCGG + Intergenic
1002140414 5:177134122-177134144 GCTGGTAGTGATGGAGGAGGGGG - Intronic
1002255204 5:177953372-177953394 GCTCCGGGGGCTGCAGGAGGTGG - Intergenic
1002338672 5:178499448-178499470 GCTGATGGAGATGTAGGAGGAGG - Intronic
1002442788 5:179273037-179273059 TCTGATCCGGATGGAGGAGGAGG - Exonic
1002482932 5:179515362-179515384 GCTCCGGGGGCTGCAGGAGGTGG + Intergenic
1002888794 6:1317034-1317056 GCTGGGGGGGAGGCGGGAGGAGG - Intergenic
1003083865 6:3045398-3045420 GCAGCTGCGGGTGCAGGAGGTGG + Intergenic
1003246768 6:4388498-4388520 CGAGAAGGGGATGCAGGAGGTGG - Intergenic
1003588984 6:7421076-7421098 GTTGATGGTGTTGCAGAAGGTGG + Intergenic
1004415741 6:15422661-15422683 CCTGATGGGGAAGCAGAAGTGGG - Intronic
1004492442 6:16129355-16129377 GCTGATGGAGGTGGAGGTGGAGG + Exonic
1004571485 6:16850069-16850091 ACTGCTGGGGCTGCGGGAGGAGG - Intergenic
1006093587 6:31642354-31642376 GGTGGTGGGGGTGGAGGAGGTGG + Exonic
1006196157 6:32243794-32243816 GCTGATGGTGAGGCGGGAGAAGG + Intergenic
1006505510 6:34486282-34486304 GCTGAGAGGGAGGGAGGAGGAGG + Intronic
1007500055 6:42289911-42289933 ACTTATGGGGGTACAGGAGGAGG + Intronic
1007735584 6:43980373-43980395 GTGGGTGGGCATGCAGGAGGGGG - Intergenic
1007817439 6:44534559-44534581 CCTGCTAGGGATGTAGGAGGAGG + Intergenic
1007834824 6:44666344-44666366 CCTGGTGGGGAGGCTGGAGGAGG + Intergenic
1009370165 6:62889438-62889460 GAGGATGGGGAAGCTGGAGGTGG + Intergenic
1010707079 6:79127775-79127797 GCTTATGGGCATGCTGGTGGTGG - Intergenic
1011410164 6:87059605-87059627 GCAGGTGGGGAGGGAGGAGGCGG + Intergenic
1012180007 6:96140777-96140799 CATGAGGGGGATGCAGTAGGAGG - Intronic
1012201419 6:96411095-96411117 GCGGAAGGTGATGCGGGAGGAGG + Intergenic
1012477739 6:99633435-99633457 GCTGATGAGGGTGCGGCAGGAGG + Intergenic
1012587816 6:100945504-100945526 GCTGAGGGAGAAGGAGGAGGTGG - Intergenic
1012932330 6:105330103-105330125 GCAGATGGAGATGCTGGTGGTGG + Intronic
1014068075 6:117150373-117150395 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1014263002 6:119241316-119241338 ACTGTTGGGGAAGCAGGAGTAGG - Intronic
1014930703 6:127332572-127332594 GGTGGTGGGGAGGCAGGAGGTGG + Intronic
1015399139 6:132768680-132768702 GCTGATGTGGAGGGAGGAGAGGG - Intergenic
1015540542 6:134309362-134309384 GGTGAAGGAGGTGCAGGAGGAGG - Intronic
1016465472 6:144320921-144320943 GCTAATGGGGATGGAGTGGGGGG + Intronic
1016805496 6:148208067-148208089 GCTGATGAGGAAGCAGGAAGAGG - Intergenic
1017884966 6:158591327-158591349 GCTGATGTGGAAGGAGCAGGTGG + Intronic
1017951607 6:159139916-159139938 GCTGGTGGGAATGCAGAATGGGG - Intergenic
1018038657 6:159903089-159903111 ACTGAAGGGGAAGGAGGAGGTGG - Intergenic
1018442463 6:163825626-163825648 GAAGATGGGGATGCGGTAGGAGG + Intergenic
1019271192 7:150058-150080 GCAGATGGGGATGCAGGCCCTGG + Intergenic
1019494774 7:1332588-1332610 GTTGAGGGCGAGGCAGGAGGGGG - Intergenic
1019903398 7:4042235-4042257 GTGGATGGGGAAGAAGGAGGTGG - Intronic
1020120420 7:5500295-5500317 GGAGCTGGGGGTGCAGGAGGCGG - Intronic
1020914486 7:14175432-14175454 GTTCCTGGGGGTGCAGGAGGTGG - Intronic
1021337037 7:19416338-19416360 GCAGAAGGGGGTGGAGGAGGAGG + Intergenic
1021685537 7:23182155-23182177 GGTGCTAGGGGTGCAGGAGGAGG + Exonic
1021911441 7:25389337-25389359 GCTGATGAGGATGCAGGCCCAGG + Intergenic
1022094481 7:27130313-27130335 GCAGCTGGGGCTGCAGGACGTGG + Exonic
1022317879 7:29262773-29262795 GAAGATGGGGGTGCAGGGGGAGG + Intronic
1022427986 7:30285653-30285675 GCTGTTCGGGATGCTGAAGGGGG - Exonic
1022698051 7:32728833-32728855 GCTGTTCGGGATGCTGAAGGAGG - Intergenic
1023286822 7:38629856-38629878 GCGGAGGGAGAGGCAGGAGGAGG + Intronic
1023871126 7:44263552-44263574 ACTGGTGGTGAAGCAGGAGGTGG + Intronic
1024101074 7:46033453-46033475 GCTGACTGGGAAGCAGCAGGTGG + Intergenic
1024171258 7:46790489-46790511 GCTGATGAGGATGCAGAACATGG + Intergenic
1024229529 7:47353750-47353772 GCTGAGGAGGGTGGAGGAGGAGG - Intronic
1024278602 7:47699509-47699531 GCTGATGGTGATGATGGTGGTGG - Intronic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1026767076 7:73166846-73166868 GATGATGGCGATGGAGGAGGAGG - Intergenic
1027202448 7:76072421-76072443 GGTCATCGGGATGCAGGAGCCGG + Intergenic
1028923422 7:96331233-96331255 GCTGATGGGGCTCCAGGCTGAGG - Intergenic
1028987397 7:97018847-97018869 GCCGCTGGGGGTGCCGGAGGAGG + Intergenic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1030162257 7:106520899-106520921 GCTACTGGGGATGGAGGAGTGGG + Intergenic
1030277442 7:107736002-107736024 GCTGATAGGGATGCAGTTTGGGG + Intergenic
1030998121 7:116383172-116383194 GGAGAAGGTGATGCAGGAGGAGG + Intronic
1032001467 7:128268135-128268157 GATGAGGGGCATGGAGGAGGGGG - Intergenic
1032036420 7:128524894-128524916 CCTGCTGGGCATGGAGGAGGAGG - Intergenic
1033501044 7:141950063-141950085 GCTGAGGAGAAAGCAGGAGGTGG - Intronic
1033807487 7:144971374-144971396 GGTGGTGGTGATGGAGGAGGAGG + Intergenic
1034183114 7:149153990-149154012 GCTGCTGGGGGTGTAGGAAGAGG - Exonic
1034339319 7:150341693-150341715 GCTGGAGGGGGTCCAGGAGGTGG - Intergenic
1034690950 7:153013262-153013284 GCAGAAGGTGACGCAGGAGGAGG - Intergenic
1035293894 7:157857113-157857135 GGAGCTGGGGATGCTGGAGGGGG + Intronic
1035312409 7:157977812-157977834 GCTGCTGGGGGAGCAGGAAGGGG + Intronic
1035371265 7:158380485-158380507 GGTCATGGTGATGCAAGAGGTGG + Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035930769 8:3777613-3777635 GCTGGTTGGGATGCTGGTGGGGG - Intronic
1036549060 8:9800791-9800813 GCTGAGGGAGAAGGAGGAGGCGG - Intergenic
1036698231 8:10993398-10993420 GCTGGTGAGGAGGGAGGAGGCGG + Intronic
1037084647 8:14833648-14833670 GCAGATGGGGACGAAGGAAGGGG + Intronic
1037442325 8:18928927-18928949 GCTGCTTGGGAGGCTGGAGGTGG - Intronic
1037468955 8:19188430-19188452 GATGTTGGGGATGTTGGAGGTGG + Intergenic
1037469219 8:19191045-19191067 GCTGTTGGGGATGTTGGAGATGG - Intergenic
1037583535 8:20261152-20261174 GATGTTGGGGATTCAGGAAGGGG + Intronic
1037733147 8:21546112-21546134 TTTTATGGGGATGCAGGAGAAGG + Intergenic
1037837398 8:22222207-22222229 GTGGATGGGGTGGCAGGAGGTGG - Intronic
1038101905 8:24387341-24387363 GCTGAGGGAGAAGGAGGAGGTGG + Intronic
1039454689 8:37698720-37698742 GCAGGTGGGGAGGGAGGAGGAGG - Exonic
1039555600 8:38472692-38472714 GCAGAAGGGGATTCGGGAGGAGG + Intergenic
1039567285 8:38560433-38560455 GCACAGGGGGATGCGGGAGGAGG - Intergenic
1040605721 8:48929233-48929255 GCTGCTGGGGAAGCAGGGTGGGG - Intergenic
1042099909 8:65264331-65264353 TCTGATGGAGATGTAGAAGGAGG - Intergenic
1042117164 8:65444823-65444845 GCTCATGGGGGGGCAGGGGGGGG - Intergenic
1042646015 8:70987521-70987543 GCTCATGCTGATGCAAGAGGTGG + Intergenic
1042840257 8:73116612-73116634 GGTGATGGGCAGGAAGGAGGTGG + Intronic
1044691029 8:94878669-94878691 GCTGAGGGGGCTGGAGGTGGAGG - Intronic
1045341831 8:101262061-101262083 GCTGAGGGGGCTGCAGGGAGAGG - Intergenic
1045785814 8:105918959-105918981 GATCATGCTGATGCAGGAGGTGG - Intergenic
1045800536 8:106096327-106096349 GCTGCCAGGGATGCAGGAGGGGG - Intergenic
1046004060 8:108458131-108458153 GGTAATGCTGATGCAGGAGGTGG + Intronic
1046107483 8:109683314-109683336 GGTGATGTTGATGCAAGAGGTGG - Intronic
1047361767 8:124175649-124175671 GCTGATGGGGAAGGAAGAGGAGG - Intergenic
1047734182 8:127751398-127751420 TCTAATGGGGAAGCAGGAGGAGG - Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1048022373 8:130551289-130551311 GCTGATGAGGATGCAGGGAAAGG - Intergenic
1048299338 8:133239750-133239772 GCTGATGGGGTGGAATGAGGAGG + Intronic
1048341065 8:133538833-133538855 GATGATGGGGAGGCAGCAAGGGG + Intronic
1048726101 8:137387070-137387092 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1048811913 8:138296174-138296196 GTTGATGAGGATGCCTGAGGAGG - Intronic
1048878478 8:138854938-138854960 GATGATGGTGATGATGGAGGAGG + Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049277900 8:141729090-141729112 GCTGATGAGGATGCAGGGCCCGG - Intergenic
1049299166 8:141860737-141860759 ACTAATGGGGGTGCAGGGGGAGG - Intergenic
1049324082 8:142012848-142012870 GCTGATGGTGATGGTGGAGATGG - Intergenic
1049397945 8:142410483-142410505 GCAGAAAGTGATGCAGGAGGTGG - Intergenic
1049534084 8:143169952-143169974 GCTAAGGGGGATGGAGGACGGGG + Intergenic
1049569132 8:143360144-143360166 GCTGACGGGCACCCAGGAGGTGG + Intergenic
1049644239 8:143728907-143728929 GGTGCTGGGGTTACAGGAGGAGG + Intronic
1049662823 8:143827955-143827977 GTTGATGGTGAAGGAGGAGGAGG - Intronic
1049680782 8:143917044-143917066 GCTGATGGGGTAGGAGGAGGAGG + Exonic
1049925172 9:400815-400837 GGTGATGGTGATGGTGGAGGTGG - Intronic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050669943 9:7984586-7984608 GGTGGTGGGGAGGCAGTAGGGGG + Intergenic
1050906499 9:11012360-11012382 CTTGATGGGCATGCAGGAGGCGG + Intergenic
1050938143 9:11424670-11424692 GCTAATGCTGATGCAAGAGGTGG + Intergenic
1051206345 9:14693174-14693196 GCGGATGGGGATGGGGGTGGGGG + Intronic
1051554458 9:18366893-18366915 GGTGATGGGGCTGCATGTGGCGG - Intergenic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1051902606 9:22059443-22059465 GGTTATGCTGATGCAGGAGGTGG + Intergenic
1053161972 9:35819455-35819477 GGTGGTGGGGATGGAGGATGGGG - Intronic
1053186562 9:36021508-36021530 GCTGATGGGGAATGAGGAGGAGG + Intergenic
1053285737 9:36848531-36848553 GCTGATGGATATGCCGGAGCCGG - Intronic
1053482079 9:38423525-38423547 GAAGTTGAGGATGCAGGAGGAGG - Intronic
1054455871 9:65430118-65430140 CCTGATGGGGAGGTGGGAGGGGG + Intergenic
1054980821 9:71203829-71203851 GATGATTGTGATGGAGGAGGAGG - Intronic
1055053378 9:72001286-72001308 GGGGAAGGGGATGCAGAAGGAGG + Intergenic
1055054373 9:72010544-72010566 GCAGATGGGGATGCCAGAAGGGG + Intergenic
1055175514 9:73313601-73313623 GGTCATGCTGATGCAGGAGGTGG + Intergenic
1056020202 9:82432248-82432270 GCTGATGGTGATGGTGGGGGAGG - Intergenic
1056874791 9:90317634-90317656 CCTCGTGGGGATGCAGCAGGTGG + Intergenic
1056950373 9:91036579-91036601 GGTGATGGGGCAGGAGGAGGAGG - Intergenic
1056956993 9:91090546-91090568 GCTGATGGGTATCGAGAAGGTGG + Intergenic
1057051575 9:91928079-91928101 GGTGAGTGTGATGCAGGAGGTGG - Intronic
1057397050 9:94689662-94689684 GCTGGTGGGAAGGCGGGAGGGGG - Intergenic
1057729869 9:97599001-97599023 GATGATGAGGATGCAGGGAGGGG - Intronic
1059247588 9:112861876-112861898 GCTGAGGAGGATGGAGGGGGCGG - Intronic
1059262181 9:112988295-112988317 CCTGTTGGGGGTGCAGCAGGAGG - Intergenic
1059407009 9:114107597-114107619 GGTGGTGGTGATGAAGGAGGTGG - Intergenic
1059431216 9:114251437-114251459 GCAGAAGGGGAAGGAGGAGGAGG - Intronic
1059432619 9:114259163-114259185 CCTGAAGGTGATACAGGAGGTGG + Intronic
1060586626 9:124790633-124790655 GCAGGTGGGGCTGGAGGAGGAGG + Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061203504 9:129150327-129150349 GCTGAAGAGGATGGAGGTGGCGG + Intergenic
1061308104 9:129744174-129744196 GGTGATGGCGATGGAGGAGATGG - Intronic
1061391045 9:130317126-130317148 GCTGAGGGGGAAGCAGGGGTGGG + Intronic
1061653840 9:132072563-132072585 GCAGGTGGGGAGGGAGGAGGAGG + Intronic
1062098578 9:134715964-134715986 GATGATGGTGATGCTGGTGGTGG + Intronic
1062392153 9:136338124-136338146 GCTCATGGGGAGGCAGGCGGTGG + Intronic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1062497215 9:136837563-136837585 GCTGAGGGGCACGCAGGTGGGGG - Exonic
1203776297 EBV:75070-75092 CCTGATGGAGATGGAGAAGGTGG + Intergenic
1185566683 X:1100094-1100116 GGAGATGGAGATGGAGGAGGAGG + Intergenic
1185611739 X:1397349-1397371 GCTGATGAGGCTGCAGGATGAGG + Intergenic
1186293238 X:8121870-8121892 GCTGAGGGGGATGGGGGAGGGGG - Intergenic
1186468646 X:9804196-9804218 GCTCATGGTGCAGCAGGAGGTGG + Intronic
1187026595 X:15441672-15441694 GATGAGGGGGAGGCAGGAGGTGG + Intronic
1187122829 X:16425685-16425707 CCAGATGGTGATGAAGGAGGAGG - Intergenic
1189341511 X:40207947-40207969 GCTACTGGGGAAGAAGGAGGGGG + Intergenic
1189463316 X:41259748-41259770 CCTGCTGGGGATGCAGGACCAGG - Intergenic
1190284410 X:48952788-48952810 GCTGGTGGGGAAGCAGGAAGGGG - Intronic
1190435083 X:50416309-50416331 GCTGAAAGGAATTCAGGAGGTGG - Intronic
1190562001 X:51695389-51695411 GCTGATGAGGGTTCAGAAGGAGG + Intergenic
1190834887 X:54091380-54091402 GCTCATGGCGATGCAGGATTCGG + Exonic
1190862333 X:54357263-54357285 GGTGAGGAGGATACAGGAGGGGG - Intronic
1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG + Exonic
1192516330 X:71763972-71763994 GCTGCTGGGGATCCACGCGGAGG - Exonic
1192547208 X:72023946-72023968 GATGGTGAGGATGAAGGAGGAGG + Intergenic
1193226512 X:78990088-78990110 GGTCATGGTGATGCAAGAGGTGG - Intergenic
1193282365 X:79668549-79668571 GCGGAAGGGGAAGCTGGAGGAGG + Intergenic
1193976469 X:88125695-88125717 CCTCATGGTGATGGAGGAGGGGG - Intergenic
1194542334 X:95190041-95190063 GGTCATGGTGATGCAAGAGGTGG + Intergenic
1195671950 X:107477328-107477350 GCTGGTGGAAATGCAGGAGGGGG + Intergenic
1195803022 X:108734426-108734448 GCTGGTGGGGGTGGAGGAGGAGG + Exonic
1196893533 X:120311575-120311597 ACTGAGGGGGAGGGAGGAGGGGG - Intergenic
1198207055 X:134476624-134476646 ACTGATGGGGATGGGGAAGGAGG - Intronic
1199327219 X:146513385-146513407 GCTCATGCTGATGCAAGAGGTGG - Intergenic
1199411479 X:147528622-147528644 TCTGATGGGGGGGGAGGAGGAGG - Intergenic
1199649695 X:149939457-149939479 GCTGAGGGGGGTGCTGGGGGCGG + Intergenic
1199874668 X:151920665-151920687 GCTGATGGGGATGAAGGTAGGGG - Intronic
1200142111 X:153907543-153907565 GCTGAGGGGCAGGCAGGATGTGG + Exonic
1200215976 X:154368471-154368493 GCCTATGGGGAACCAGGAGGAGG + Intronic