ID: 1050158256

View in Genome Browser
Species Human (GRCh38)
Location 9:2690769-2690791
Sequence CTCTGCTGATACCTTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050158256_1050158257 -7 Left 1050158256 9:2690769-2690791 CCAGAATCAAGGTATCAGCAGAG No data
Right 1050158257 9:2690785-2690807 AGCAGAGTTTATTTCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050158256 Original CRISPR CTCTGCTGATACCTTGATTC TGG (reversed) Intergenic
No off target data available for this crispr