ID: 1050161201

View in Genome Browser
Species Human (GRCh38)
Location 9:2719973-2719995
Sequence CCTGATTAACATTTATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050161201_1050161204 15 Left 1050161201 9:2719973-2719995 CCTGGAAATAAATGTTAATCAGG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1050161204 9:2720011-2720033 GAATAAGTCGGCATATATGAAGG No data
1050161201_1050161203 3 Left 1050161201 9:2719973-2719995 CCTGGAAATAAATGTTAATCAGG 0: 1
1: 0
2: 0
3: 21
4: 225
Right 1050161203 9:2719999-2720021 TCTCAGATCGATGAATAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050161201 Original CRISPR CCTGATTAACATTTATTTCC AGG (reversed) Intronic
903782393 1:25829410-25829432 CCTACTGAACATTCATTTCCTGG - Intronic
904715943 1:32467736-32467758 CCTGTTTATTATTTATGTCCTGG - Intronic
905968402 1:42118919-42118941 CCTGACTTAAATTTATTTCTCGG + Intergenic
906773955 1:48511714-48511736 ACTCATTCACATTTGTTTCCTGG + Intergenic
908477543 1:64505054-64505076 CCAGAAGAACATTTATTTTCTGG + Intronic
908995564 1:70148853-70148875 TCTGTTTAACATGTATTTCAAGG - Intronic
910893679 1:92044739-92044761 CCTCATAAATCTTTATTTCCAGG - Intronic
912215022 1:107599768-107599790 CCAGATTTAAATTTAATTCCAGG + Intronic
912488034 1:110044614-110044636 ACTAGTTAACATGTATTTCCAGG + Intronic
914340191 1:146753675-146753697 TCTGATTAGCTTCTATTTCCTGG - Intergenic
914394780 1:147255013-147255035 CTTGATTAAGATTTTTTTTCTGG + Intronic
915046574 1:153022342-153022364 CTTGATTAACTTTTATATCTTGG - Intergenic
916485395 1:165254083-165254105 TCTGTTTAACAGTTAATTCCAGG - Intronic
917637050 1:176947569-176947591 CTTGAGTCACATCTATTTCCTGG - Intronic
918623227 1:186629149-186629171 CCTGATCTACATTTCTTTCAGGG - Intergenic
919157623 1:193787215-193787237 ACAGATTAACATTTACTTCCAGG + Intergenic
919817419 1:201450304-201450326 CCTCATGAAAATTTATTACCAGG + Intergenic
922941614 1:229471987-229472009 CCTGACTTGAATTTATTTCCTGG + Intronic
923120384 1:230984623-230984645 CTTGATTAACTTTTATATCTAGG + Intronic
923648937 1:235853751-235853773 CCTGAGTTTCCTTTATTTCCTGG - Intronic
1066230744 10:33430491-33430513 CCTGTTTAACTTTCTTTTCCAGG - Intergenic
1067021549 10:42804137-42804159 GTTGATAAACAATTATTTCCAGG + Intronic
1067859964 10:49835695-49835717 CCTGGATACCATTTCTTTCCTGG - Intronic
1068820328 10:61368860-61368882 TTTGATAAACATTTATTTTCTGG - Intergenic
1069297549 10:66865501-66865523 GCTAATTAAAATTTATTTCAAGG - Intronic
1071885378 10:89943989-89944011 CTTCATTAACATTTAATTGCAGG - Intergenic
1073995150 10:109307137-109307159 CTTGATTAACTTTTATATCTTGG + Intergenic
1076156942 10:128211489-128211511 CCTGAGAAACGTTTATTTCCAGG + Intergenic
1076797701 10:132806371-132806393 TCTGATTTGAATTTATTTCCTGG + Intergenic
1078300851 11:10130714-10130736 CATGACTACCATTAATTTCCTGG + Intronic
1079024144 11:16932590-16932612 ACTAATAAACATTTATTTTCAGG + Intronic
1080090120 11:28337941-28337963 TCTGATTAACATCTATTTCTGGG - Intergenic
1080323243 11:31039781-31039803 TCTTATTAACACTGATTTCCTGG - Intronic
1080540601 11:33260440-33260462 CCTGATTCACATCCATTTCATGG + Intronic
1081062462 11:38497273-38497295 CTTGATTAACATATAATTTCTGG + Intergenic
1081090405 11:38858266-38858288 TCTGATTAATAAATATTTCCAGG - Intergenic
1082655284 11:55847658-55847680 CATTATTAACATTTTTTTACTGG + Intergenic
1086009455 11:82082115-82082137 CCTGATTAATATCAATTTCATGG + Intergenic
1087336263 11:96848582-96848604 CCTGGTTACCATTTCATTCCTGG + Intergenic
1087373103 11:97309537-97309559 CCTGATTAATATGTATTTGCAGG - Intergenic
1087561385 11:99795436-99795458 CCTGATTAAGAATCATTTTCTGG + Intronic
1088060253 11:105640502-105640524 CCAGATTAACATTTTATTCTAGG + Intronic
1088195218 11:107266511-107266533 CCTGATTTCCATTGATTGCCAGG - Intergenic
1089910581 11:122095978-122096000 ACTAATTAGCATTTATTGCCTGG + Intergenic
1090450908 11:126805614-126805636 CCTGAAGAACATTTATTTTCAGG + Intronic
1092438789 12:8477967-8477989 GCAGAATAAAATTTATTTCCAGG - Exonic
1096421056 12:51458171-51458193 TCTCATCTACATTTATTTCCTGG + Intronic
1097349534 12:58533391-58533413 ACTGAGTAATATTTATTCCCTGG + Intergenic
1097443124 12:59635312-59635334 CCTTATTAACATTGATTGCCTGG + Intronic
1097858373 12:64492177-64492199 CCTAGTGGACATTTATTTCCAGG + Intronic
1098209953 12:68152991-68153013 CTAGATTAAAATTTATCTCCTGG + Intergenic
1100694133 12:97072930-97072952 CCTAATGATCATCTATTTCCTGG + Intergenic
1101273448 12:103173010-103173032 CCCTAAAAACATTTATTTCCTGG - Intergenic
1105217933 13:18300373-18300395 CCTAATTATCTTTTTTTTCCTGG - Intergenic
1106055971 13:26237467-26237489 CCTCTTCAACATTTATTTCTTGG - Intergenic
1106701325 13:32232410-32232432 CCTGACTAACACGTGTTTCCAGG - Intronic
1109957853 13:69591374-69591396 CATAATTATCATTTATTTCAAGG + Intergenic
1110056991 13:70985824-70985846 GGTGATTAACATTTGGTTCCTGG + Intergenic
1110633118 13:77733120-77733142 ACTGAATAACATTTATTCCACGG - Intronic
1111701165 13:91691644-91691666 TCTAATTCACATTGATTTCCAGG - Intronic
1112660706 13:101504141-101504163 CTTTATAAACATATATTTCCAGG + Intronic
1115028912 14:28772126-28772148 CCAAATTAAAGTTTATTTCCAGG + Intergenic
1115430705 14:33315202-33315224 CCAGATAAACATTTGTTTGCTGG - Intronic
1117392615 14:55276606-55276628 CTTGATTAACTTTTATATCTTGG + Intronic
1117848795 14:59944336-59944358 GCGTATTCACATTTATTTCCAGG - Intronic
1120461192 14:84798186-84798208 TGTGATTTACATTTATTTTCTGG - Intergenic
1123151222 14:106183747-106183769 CTTGATTAACTTTTATATCTTGG + Intergenic
1202847794 14_GL000009v2_random:197155-197177 CCTGGTTAATCTTTATTTTCAGG - Intergenic
1202917268 14_GL000194v1_random:187695-187717 CCTGGTTAATCTTTATTTTCAGG - Intergenic
1123399633 15:19971633-19971655 CTTGATTAACTTTTATATCTTGG + Intergenic
1124060180 15:26284694-26284716 CATCATTTACATTTATTTACTGG - Intergenic
1124265423 15:28228911-28228933 CTATATTAATATTTATTTCCTGG - Intronic
1124453443 15:29819981-29820003 CTTGATAGACATTTGTTTCCAGG - Intronic
1125241239 15:37579231-37579253 CCTATTTAACTTTTAATTCCAGG - Intergenic
1125355495 15:38813348-38813370 CCTCATTAACAAGTATTTACTGG + Intergenic
1126432019 15:48596411-48596433 CTTCATTAGCATTTATTTTCAGG - Intronic
1131083817 15:89558864-89558886 TCTTATTAACACTTATCTCCTGG - Intergenic
1131332207 15:91511985-91512007 TCTGATTAATATTCATTTACAGG + Intergenic
1131615171 15:94008523-94008545 CCTGGTTAATTTGTATTTCCTGG - Intergenic
1133695583 16:8259619-8259641 CCTGCTTATCATTTCATTCCTGG + Intergenic
1133985315 16:10663852-10663874 CCTGCTCAACATTTATCTCCTGG - Intronic
1135477604 16:22790550-22790572 CCTAAAAAACAGTTATTTCCTGG - Intergenic
1136703599 16:32166246-32166268 CTATATTAATATTTATTTCCTGG - Intergenic
1137825739 16:51493297-51493319 ACTGATGAACATTTCTATCCGGG + Intergenic
1138314016 16:56052836-56052858 CATGGTTATGATTTATTTCCTGG + Intergenic
1139994097 16:70963733-70963755 TCTGATTAGCTTCTATTTCCTGG + Intronic
1140684660 16:77421849-77421871 TCTGATTAATGTTTATTTCCAGG - Intronic
1203066458 16_KI270728v1_random:1023478-1023500 CTATATTAATATTTATTTCCTGG + Intergenic
1142844255 17:2659926-2659948 TGTGATTAAAATTTATTTCCAGG - Intronic
1151541951 17:74769163-74769185 CTTGATTAACATGATTTTCCTGG + Exonic
1160459633 18:79028596-79028618 CCTGAAGAACATTTTTTTTCTGG - Intergenic
1160596433 18:79978155-79978177 CCTGAGTGAAATTTAATTCCTGG - Intronic
1161603664 19:5202103-5202125 CCCAATTAAGAGTTATTTCCAGG + Intronic
1167980558 19:53271671-53271693 CCTGAATAACATTTGTTTGTAGG - Intergenic
925504980 2:4552548-4552570 CATAATTAATATTTATTTCTAGG - Intergenic
926041965 2:9680658-9680680 CCTGATTAACACTTATTCTTAGG + Intergenic
929651141 2:43680904-43680926 CCTGGTTGAAATTTATGTCCAGG + Intronic
930470374 2:51805106-51805128 CCTGCTTAACATGTGTTGCCTGG - Intergenic
931255071 2:60564173-60564195 CAGGATTAATATTTGTTTCCTGG - Intergenic
933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG + Intronic
933283919 2:80363785-80363807 TCTCATGAAAATTTATTTCCTGG - Intronic
933443164 2:82340751-82340773 CATTATTTACATTTATTTCTGGG + Intergenic
933911949 2:86948897-86948919 CCTTGTTTACATTTATTCCCAGG + Intronic
934011046 2:87820997-87821019 CCTTGTTTACATTTATTCCCAGG - Intronic
935774608 2:106461712-106461734 CCTTGTTTACATTTATTCCCAGG - Intronic
935905459 2:107834205-107834227 CCTTGTTTACATTTATTCCCAGG + Intronic
935991824 2:108725927-108725949 CCTTGTTTACATTTATTCCCAGG + Intronic
936127251 2:109799443-109799465 CCTTGTTTACATTTATTCCCAGG + Intronic
936217446 2:110572042-110572064 CCTTGTTTACATTTATTCCCAGG - Intronic
936426588 2:112426619-112426641 CCTTGTTTACATTTATTCCCAGG - Intronic
938913108 2:135904322-135904344 CATGGGAAACATTTATTTCCGGG + Intergenic
940774493 2:157872615-157872637 CTTGCTTTACAATTATTTCCTGG + Intronic
942260814 2:174161381-174161403 ACTGTTTTACATTTATTTCTAGG - Intronic
943179243 2:184522722-184522744 CATGATTGACATGTATTTCCTGG - Intergenic
944972911 2:205014508-205014530 ATTCATTAACATTTATTTCTGGG + Intronic
945959934 2:216122444-216122466 CATGTTTCTCATTTATTTCCAGG + Intronic
946894185 2:224306348-224306370 CTTGAGTTACATTTATCTCCAGG - Intergenic
947040031 2:225907284-225907306 AATGATTAACATTTATTTAAAGG - Intergenic
1169360241 20:4942400-4942422 TCAGGTTTACATTTATTTCCAGG - Intronic
1175881722 20:62263151-62263173 CCTGAGGAGCATTTCTTTCCAGG - Intronic
1177310657 21:19388104-19388126 CCTTTATAACATTTATTTCCAGG - Intergenic
1177406167 21:20671309-20671331 CCTGATTAGCTTTTATTTCTAGG - Intergenic
1179616421 21:42586445-42586467 CCTGCTGGACATTTGTTTCCTGG - Intergenic
1181423513 22:22818208-22818230 CATAATAAACATTCATTTCCAGG + Intronic
1182046789 22:27281075-27281097 CCTAGATAACATTTATTTCATGG - Intergenic
1184135629 22:42547941-42547963 CTTGATTAACTTTTATATCTTGG + Intergenic
1185196238 22:49471595-49471617 CCTTATTAAAAATCATTTCCTGG + Intronic
949345076 3:3068982-3069004 ACTGACTACCATATATTTCCAGG - Intronic
951375237 3:21906689-21906711 GCTGTTTAACAATTCTTTCCAGG + Intronic
952424577 3:33162643-33162665 CATGATAAAAATTTATATCCAGG + Intronic
952506816 3:34014904-34014926 CCTTATTACAATTTATTTCTCGG + Intergenic
958593100 3:96185627-96185649 CCTGCTCAAAATTTACTTCCTGG - Intergenic
963122263 3:141786232-141786254 CCTCATCAATATTTTTTTCCTGG - Intronic
964268410 3:154927536-154927558 CATGATTAATATTTACTCCCAGG - Intergenic
965005807 3:163020684-163020706 CCAGATTATTATTTATTTACAGG + Intergenic
965103678 3:164334099-164334121 CTTGATTAACTTTTATATCCTGG + Intergenic
965104699 3:164341504-164341526 CTTGATTAACTTTTATATCTTGG + Intergenic
965482854 3:169241727-169241749 CCTGTTCAACATTTCTTTCCTGG - Intronic
966634423 3:182116097-182116119 CCTCATTAACATTGACCTCCTGG - Intergenic
967119981 3:186374171-186374193 CCAGTTTGACATTTTTTTCCTGG - Intergenic
967508420 3:190281017-190281039 CCTGATTATAATCTAATTCCTGG - Intergenic
967574234 3:191071627-191071649 CCTCCTTAACCTTTATTTCTAGG + Intergenic
968836833 4:2971155-2971177 GCTTATTAACATTTATGTCATGG + Intronic
969683946 4:8658864-8658886 CCTATTTTACATTTATTGCCAGG + Intergenic
970977145 4:22055405-22055427 CATTATTTACATTTATTGCCAGG + Intergenic
970998978 4:22301266-22301288 TCTGCTTAACATTTTTTTCATGG + Intergenic
971332213 4:25691312-25691334 ACTCATTCTCATTTATTTCCCGG - Intergenic
971912384 4:32810609-32810631 CGTGATTAACATTTAGCTCATGG + Intergenic
972170444 4:36339300-36339322 CCTAATAAATACTTATTTCCTGG + Intronic
972330383 4:38058602-38058624 CCTGTTTTACATTTATATTCTGG + Intronic
974808445 4:66914355-66914377 ACTGATGAACATTTATTTCTTGG - Intergenic
975357714 4:73427495-73427517 CCTGACTTACAATAATTTCCTGG + Intergenic
975475067 4:74813768-74813790 CCTGAATTACATTTACTTCAGGG + Intergenic
976308218 4:83582698-83582720 CCTCATTCAGATTTATTACCAGG + Intronic
976660339 4:87534205-87534227 CCTGATGAAAATCTATTTTCTGG - Intergenic
977340484 4:95751258-95751280 CCTGATTCACATTTCTATCAGGG + Intergenic
978627917 4:110708428-110708450 CCTGCTTCACATTTCTTTACAGG - Intergenic
978704365 4:111688771-111688793 TTTGATTTACATTTTTTTCCAGG - Intergenic
980421620 4:132567255-132567277 CCTAAGTAACATGTATTTACAGG + Intergenic
980545847 4:134260385-134260407 GGTGATTAACATTTGATTCCTGG + Intergenic
984730856 4:183066686-183066708 CCTGATTTCCATTTTTTTCTGGG - Intergenic
985347020 4:189016905-189016927 AAGGATTAAAATTTATTTCCTGG + Intergenic
986158695 5:5203088-5203110 AATGATAAACATTTATTTTCAGG + Intronic
988698179 5:33645090-33645112 CCAGTTTCACCTTTATTTCCAGG + Intronic
989047053 5:37283516-37283538 TGTGATTAACATTCATCTCCTGG + Intergenic
989754069 5:44930921-44930943 CCTCCTTTACATTTATTCCCTGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990893579 5:60673488-60673510 CTTGATTAACACTTCTTTTCCGG - Intronic
990978691 5:61582036-61582058 CCTTATTAATATTTATTTTATGG - Intergenic
991458494 5:66831265-66831287 CCTAGTAAACATTTATTTACAGG + Intronic
991533721 5:67643222-67643244 CATGATAACCATTTTTTTCCTGG - Intergenic
991711118 5:69409395-69409417 CTTGATGAACATTTCATTCCAGG - Intronic
993649184 5:90497685-90497707 CCTTTTTTACATTTATTTCTTGG - Exonic
994156801 5:96513076-96513098 CCTGATTATCATTCATTCTCGGG + Intergenic
996411465 5:123163770-123163792 CTTGTTTAACATTTATTCCCAGG - Intronic
996601699 5:125271709-125271731 CCTGATTAATGTTTATTTTTTGG + Intergenic
997056952 5:130454841-130454863 CATGGTTTACATTTATTGCCTGG - Intergenic
997267979 5:132508616-132508638 CTTGATTAAAATTTATTGGCTGG - Intergenic
997619563 5:135277054-135277076 CCTGATCCACATTTATTCCCTGG + Intronic
998661747 5:144246404-144246426 TCTGATAAACATTTATTTAGGGG + Intronic
999902987 5:156106920-156106942 CATGGTTAACAATTCTTTCCAGG - Intronic
1000282208 5:159791928-159791950 CCTGATTATCATATACTTCCTGG - Intergenic
1001061932 5:168498664-168498686 CCTCTTTAAAAATTATTTCCTGG + Intronic
1001429060 5:171645293-171645315 CCTCATTTACATTTCCTTCCTGG + Intergenic
1001576537 5:172768274-172768296 CCTGCTTAAGATATATTTACAGG + Exonic
1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG + Intergenic
1005203885 6:23378905-23378927 CCTGTTTATCATTTATTTAAGGG - Intergenic
1009533195 6:64846913-64846935 CCTGGTTAACAACTATTTCTGGG + Intronic
1011813919 6:91166171-91166193 CCTGAGTTACAAGTATTTCCCGG + Intergenic
1012141835 6:95635126-95635148 CCTCGTGAACATTTTTTTCCAGG + Intergenic
1013020048 6:106205574-106205596 CCTGTTTAGCATTTTTTTTCAGG - Intronic
1014810358 6:125878718-125878740 CATGCTTAAAATTTTTTTCCAGG + Intronic
1015036165 6:128657220-128657242 CCTAATTAGCATTATTTTCCTGG + Intergenic
1015198969 6:130557299-130557321 ATTGTTTAATATTTATTTCCTGG + Intergenic
1015483072 6:133736390-133736412 CCTGTTTAATATGTATTTCTTGG - Intergenic
1015607066 6:134968676-134968698 GCTGATTAGCATTAATGTCCAGG - Intronic
1015870497 6:137771420-137771442 CATGCCAAACATTTATTTCCAGG + Intergenic
1016995274 6:149957996-149958018 TCTGTTTAACATTTATAGCCTGG + Intergenic
1017286504 6:152682517-152682539 CTTGATTAACTTTTATATCTTGG - Intergenic
1017713197 6:157188022-157188044 CCTTTTTAACATGTGTTTCCAGG + Intronic
1018475499 6:164136401-164136423 CTTATTTAAAATTTATTTCCTGG - Intergenic
1018518009 6:164609375-164609397 CCTGATCAGCTTTTATTGCCTGG + Intergenic
1018562177 6:165112091-165112113 CCTCAGTTACATTTATTTCTAGG + Intergenic
1019843465 7:3473628-3473650 CATGACTACCTTTTATTTCCTGG + Intronic
1020334430 7:7051809-7051831 CCAGAATCACATTTCTTTCCTGG - Intergenic
1020897144 7:13954503-13954525 CCTGTTTAATATTTAGCTCCTGG + Intronic
1022176177 7:27874051-27874073 ACTCATTAACATTTATTTGGAGG + Intronic
1022942288 7:35252663-35252685 GCTGTGTAACAATTATTTCCTGG + Intronic
1023684747 7:42722821-42722843 CCTAATTAACATTTGTTACTTGG + Intergenic
1027942433 7:84701315-84701337 TTTGATTAAAATTTATATCCAGG + Intergenic
1028065082 7:86374441-86374463 TCTAATTAACTCTTATTTCCTGG + Intergenic
1028842003 7:95438520-95438542 CCTGGTTTACGTTTGTTTCCTGG + Intergenic
1029866303 7:103634245-103634267 CATGATTAAAATATACTTCCAGG + Intronic
1033847649 7:145453840-145453862 CAAGATCAACAGTTATTTCCCGG - Intergenic
1036126666 8:6069262-6069284 CCTGAGAAAAGTTTATTTCCAGG + Intergenic
1037026017 8:14039175-14039197 ACTTTTTAACACTTATTTCCTGG + Intergenic
1037182447 8:16024071-16024093 CCAGATTAAGCATTATTTCCAGG - Intergenic
1037193291 8:16153901-16153923 CCTGAATAAAAATTCTTTCCTGG + Intronic
1039752691 8:40492820-40492842 CCTGGATAATGTTTATTTCCTGG - Intergenic
1040031954 8:42832845-42832867 CGTGATTAACTTTTATATCTTGG + Intergenic
1041198601 8:55427009-55427031 CCTGATTCACTTTTATTACCTGG - Intronic
1041603567 8:59752449-59752471 CCTCATAGACATTTTTTTCCAGG - Intergenic
1042261662 8:66866158-66866180 CCTTATTTACATTTATTCCTAGG - Intergenic
1042370094 8:67981736-67981758 CCTGATTAATATATATTTTAAGG - Intronic
1042723904 8:71851878-71851900 CCTACTTAACATTCATTTTCTGG - Intronic
1043614570 8:82109569-82109591 CCTAATTTGCATTTATTTCTAGG - Intergenic
1043936639 8:86149857-86149879 CCCCAGTAAGATTTATTTCCCGG - Intronic
1044978170 8:97687395-97687417 ACTGAATAACATTTTTTTTCTGG + Intronic
1045446869 8:102275652-102275674 CCTGATAAGCATGTATTTCAGGG - Intronic
1046120181 8:109836452-109836474 CATGACTGTCATTTATTTCCTGG - Intergenic
1048090070 8:131230319-131230341 ACTATGTAACATTTATTTCCTGG - Intergenic
1050161201 9:2719973-2719995 CCTGATTAACATTTATTTCCAGG - Intronic
1050836401 9:10085311-10085333 CCTGATTAACATTGACATCATGG + Intronic
1052335419 9:27314657-27314679 CCTAATTAAAATCTATTACCAGG - Intergenic
1056818627 9:89820751-89820773 CCTAAATAAAATCTATTTCCAGG + Intergenic
1057615992 9:96590628-96590650 CCTCGCCAACATTTATTTCCTGG + Intronic
1057953273 9:99386684-99386706 CCCGATGAACAGTTATTTCCGGG - Intergenic
1058951744 9:109910452-109910474 ATTGATTAACATTTAATTCTTGG - Intronic
1061115514 9:128608316-128608338 CCTGATTGACATCTGTTTCTTGG + Intronic
1186150541 X:6670085-6670107 CCACATGATCATTTATTTCCAGG + Intergenic
1186619084 X:11218381-11218403 CCTGATTAACATTAATGTGAAGG - Intronic
1188070785 X:25715699-25715721 CCTGATTTAGATTTATTTTAGGG + Intergenic
1188297112 X:28462883-28462905 ACTGGTTAAAATTTATTTACTGG - Intergenic
1194390149 X:93307508-93307530 GGTGATTAACCTTTTTTTCCTGG - Intergenic
1194527650 X:94997664-94997686 TCTGATCAACATTTATTTTCAGG + Intergenic
1196944952 X:120814535-120814557 CTTGATTAACTTTTATACCCAGG - Intergenic
1197721463 X:129747539-129747561 CCTGAATCACAATTTTTTCCTGG + Intronic