ID: 1050171555

View in Genome Browser
Species Human (GRCh38)
Location 9:2824749-2824771
Sequence CACACACGATGGCGCCAGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050171555_1050171563 26 Left 1050171555 9:2824749-2824771 CCACTCTGGCGCCATCGTGTGTG 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1050171563 9:2824798-2824820 GATGGCTTCAATCATTTCCTAGG 0: 1
1: 0
2: 0
3: 14
4: 214
1050171555_1050171559 4 Left 1050171555 9:2824749-2824771 CCACTCTGGCGCCATCGTGTGTG 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1050171559 9:2824776-2824798 CCAGGTAGACCACCGCTTCGCGG 0: 1
1: 0
2: 0
3: 3
4: 36
1050171555_1050171560 8 Left 1050171555 9:2824749-2824771 CCACTCTGGCGCCATCGTGTGTG 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1050171560 9:2824780-2824802 GTAGACCACCGCTTCGCGGATGG 0: 1
1: 0
2: 0
3: 1
4: 9
1050171555_1050171564 27 Left 1050171555 9:2824749-2824771 CCACTCTGGCGCCATCGTGTGTG 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1050171564 9:2824799-2824821 ATGGCTTCAATCATTTCCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050171555 Original CRISPR CACACACGATGGCGCCAGAG TGG (reversed) Exonic
906100171 1:43255279-43255301 CTCCCAGGATGGCGCCTGAGAGG - Intronic
906801920 1:48745472-48745494 CCAACAGGATGGAGCCAGAGAGG - Intronic
908766826 1:67561821-67561843 ACCAGACGGTGGCGCCAGAGAGG + Intergenic
1072280657 10:93862653-93862675 CACACAGGATGCACCCAGAGAGG + Intergenic
1072673102 10:97446155-97446177 CACACGCGCAGGCGCCAGCGTGG - Exonic
1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG + Intergenic
1076592255 10:131591656-131591678 CTCACACGGTGGAGACAGAGAGG - Intergenic
1077432284 11:2521857-2521879 CACACACTAGGGCCCCTGAGTGG - Intronic
1083826287 11:65205756-65205778 CACCCCTGATGGTGCCAGAGGGG + Intronic
1097734912 12:63171669-63171691 GACACAAAATGGAGCCAGAGTGG + Intergenic
1101837848 12:108307552-108307574 CAAACACAAGGGCTCCAGAGCGG - Intronic
1102081150 12:110099057-110099079 GACACACGATGAAGCCATAGTGG - Intergenic
1102819861 12:115898872-115898894 GCCACATGATGGAGCCAGAGAGG + Intergenic
1104909073 12:132231023-132231045 CACACTCGATGGGGCGACAGAGG + Intronic
1104909081 12:132231071-132231093 CACACTCGATGGGGCGACAGAGG + Intronic
1104909100 12:132231167-132231189 CACACTCGATGGGGCGACAGAGG + Intronic
1104909109 12:132231216-132231238 CACACTCGATGGGGCGACAGAGG + Intronic
1104909117 12:132231264-132231286 CACACTCGATGGGGCGACAGAGG + Intronic
1104909125 12:132231312-132231334 CACACTCGATGGGGCGACAGAGG + Intronic
1104909134 12:132231360-132231382 CACACTCGATGGGGCGACAGAGG + Intronic
1104909142 12:132231408-132231430 CACACTCGATGGGGCGACAGAGG + Intronic
1104909150 12:132231456-132231478 CACACTCGATGGGGCGACAGAGG + Intronic
1104909159 12:132231504-132231526 CACACTCGATGGGGCGACAGAGG + Intronic
1104909168 12:132231552-132231574 CACACTCGATGGGGCGACAGAGG + Intronic
1104909177 12:132231600-132231622 CACACTCGATGGGGCGACAGAGG + Intronic
1104909186 12:132231648-132231670 CACACTCGATGGGGCGACAGAGG + Intronic
1104909194 12:132231696-132231718 CACACTCGATGGGGCGACAGAGG + Intronic
1104909211 12:132231789-132231811 CACACTCGATGGGGCGACAGAGG + Intronic
1104909219 12:132231837-132231859 CACACTCGATGGGGCGACAGAGG + Intronic
1104909227 12:132231885-132231907 CACACTCGATGGGGCGACAGAGG + Intronic
1104909235 12:132231933-132231955 CACACTCGATGGGGCGACAGAGG + Intronic
1104909243 12:132231981-132232003 CACACTCGATGGGGCGACAGAGG + Intronic
1104909251 12:132232029-132232051 CACACTCGATGGGGCGACAGAGG + Intronic
1104909260 12:132232077-132232099 CACACTCGATGGGGCGACAGAGG + Intronic
1104909268 12:132232125-132232147 CACACTCGATGGGGCGACAGAGG + Intronic
1104909276 12:132232173-132232195 CACACTCGATGGGGCGACAGAGG + Intronic
1104909284 12:132232221-132232243 CACACTCGATGGGGCGACAGAGG + Intronic
1104909301 12:132232314-132232336 CACACTCGATGGGGCGACAGAGG + Intronic
1104909309 12:132232362-132232384 CACACTCGATGGGGCGACAGAGG + Intronic
1104909317 12:132232410-132232432 CACACTCGATGGGGCGACAGAGG + Intronic
1104909325 12:132232458-132232480 CACACTCGATGGGGCGACAGAGG + Intronic
1104909333 12:132232506-132232528 CACACTCGATGGGGCGACAGAGG + Intronic
1104909341 12:132232554-132232576 CACACTCGATGGGGCGACAGAGG + Intronic
1104909349 12:132232602-132232624 CACACTCGATGGGGCGACAGAGG + Intronic
1104909357 12:132232650-132232672 CACACTCGATGGGGCGACAGAGG + Intronic
1104909365 12:132232698-132232720 CACACTCGATGGGGCGACAGAGG + Intronic
1104909373 12:132232746-132232768 CACACTCGATGGGGCGACAGAGG + Intronic
1104909381 12:132232794-132232816 CACACTCGATGGGGCGACAGAGG + Intronic
1104909389 12:132232842-132232864 CACACTCGATGGGGCGACAGAGG + Intronic
1104909397 12:132232890-132232912 CACACTCGATGGGGCGACAGAGG + Intronic
1104909405 12:132232938-132232960 CACACTCGATGGGGCGACAGAGG + Intronic
1104909413 12:132232986-132233008 CACACTCGATGGGGCGACAGAGG + Intronic
1104909421 12:132233034-132233056 CACACTCGATGGGGCGACAGAGG + Intronic
1104909429 12:132233082-132233104 CACACTCGATGGGGCGACAGAGG + Intronic
1104909448 12:132233177-132233199 CACACTCGATGGGGCGACAGAGG + Intronic
1104909456 12:132233225-132233247 CACACTCGATGGGGCGACAGAGG + Intronic
1104909465 12:132233273-132233295 CACACTCGATGGGGCGACAGAGG + Intronic
1104909473 12:132233321-132233343 CACACTCGATGGGGCGACAGAGG + Intronic
1104909482 12:132233369-132233391 CACACTCGATGGGGCGACAGAGG + Intronic
1104909491 12:132233417-132233439 CACACTCGATGGGGCGACAGAGG + Intronic
1104909497 12:132233465-132233487 CACACTCGATGGCGTGAGAGAGG + Intronic
1104909514 12:132233561-132233583 CACACTCGATGGGGCGACAGAGG + Intronic
1104909523 12:132233609-132233631 CACACTCGATGGGGCGACAGAGG + Intronic
1104909529 12:132233657-132233679 CACACTCGATGGCGTGAGAGAGG + Intronic
1104909537 12:132233705-132233727 CACACTCGATGGGGCGACAGAGG + Intronic
1104909546 12:132233753-132233775 CACACTCGATGGGGCGACAGAGG + Intronic
1104909554 12:132233801-132233823 CACACTCGATGGGGCGACAGAGG + Intronic
1104909562 12:132233849-132233871 CACACTCGATGGGGCGACAGAGG + Intronic
1104909570 12:132233897-132233919 CACACTCGATGGGGCGACAGAGG + Intronic
1104909579 12:132233945-132233967 CACACTCGATGGGGCGACAGAGG + Intronic
1104909588 12:132233993-132234015 CACACTCGATGGGGCGACAGAGG + Intronic
1104909594 12:132234041-132234063 CACACTCGATGGCGTGAGAGAGG + Intronic
1104909602 12:132234089-132234111 CACACTCGATGGGGCGACAGAGG + Intronic
1104909610 12:132234137-132234159 CACACTCGATGGGGCGACAGAGG + Intronic
1104909618 12:132234185-132234207 CACACTCGATGGGGCGACAGAGG + Intronic
1104909626 12:132234233-132234255 CACACTCGATGGGGCGACAGAGG + Intronic
1104909634 12:132234281-132234303 CACACTCGATGGGGCGACAGAGG + Intronic
1104909642 12:132234329-132234351 CACACTCGATGGGGCGACAGAGG + Intronic
1104909651 12:132234377-132234399 CACACTCGATGGGGCGACAGAGG + Intronic
1104909659 12:132234425-132234447 CACACTCGATGGGGCGACAGAGG + Intronic
1104909667 12:132234473-132234495 CACACTCGATGGGGCGACAGAGG + Intronic
1104909675 12:132234521-132234543 CACACTCGATGGGGCGACAGAGG + Intronic
1104909684 12:132234569-132234591 CACACTCGATGGGGCGACAGAGG + Intronic
1104909693 12:132234617-132234639 CACACTCGATGGGGCGACAGAGG + Intronic
1104909699 12:132234665-132234687 CACACTCGATGGCGTGAGAGAGG + Intronic
1104909705 12:132234713-132234735 CACACTCGATGGCGTGAGAGAGG + Intronic
1104909713 12:132234761-132234783 CACACTCGATGGGGCGACAGAGG + Intronic
1104909722 12:132234809-132234831 CACACTCGATGGGGCGACAGAGG + Intronic
1104909730 12:132234857-132234879 CACACTCGATGGGGCGACAGAGG + Intronic
1104909738 12:132234905-132234927 CACACTCGATGGGGCGACAGAGG + Intronic
1104909746 12:132234953-132234975 CACACTCGATGGGGCGACAGAGG + Intronic
1104909755 12:132235001-132235023 CACACTCGATGGGGCGACAGAGG + Intronic
1104909764 12:132235049-132235071 CACACTCGATGGGGCGACAGAGG + Intronic
1104909770 12:132235097-132235119 CACACTCGATGGCGTGAGAGAGG + Intronic
1104909786 12:132235190-132235212 CACACTCGATGGCGTGAGAGAGG + Intronic
1106183447 13:27387491-27387513 CACACACGGCTGGGCCAGAGGGG - Intergenic
1108055099 13:46477695-46477717 CAGACAAGATGGCGCCACAAAGG - Intergenic
1112486859 13:99827770-99827792 CACATACGATGGCGCCTGTCGGG - Intronic
1113388538 13:109873615-109873637 CACACACGGTGGCCTCAGTGTGG + Intergenic
1115713494 14:36076324-36076346 CACATCCCATGGGGCCAGAGTGG + Intergenic
1117026117 14:51621861-51621883 CACACAAGCTGGGGCCAGATGGG - Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1131561110 15:93440861-93440883 CACAGACGGTGGCCCCAGTGAGG - Intergenic
1132602931 16:781954-781976 CACAGACGTGGGCCCCAGAGTGG - Exonic
1137343767 16:47636348-47636370 CACACTTCATGGAGCCAGAGGGG + Intronic
1138138619 16:54546740-54546762 CACACACGATGCCAGCAAAGAGG + Intergenic
1140303290 16:73779076-73779098 CCCACCAGATGGCTCCAGAGTGG + Intergenic
1144106660 17:11992378-11992400 CACACCTGATGGGACCAGAGAGG + Intronic
1150636613 17:66917703-66917725 CACCCACGATGGTTCCAAAGGGG + Intergenic
1152260023 17:79261796-79261818 CACACAAGAGGCCCCCAGAGCGG + Intronic
1152366197 17:79857930-79857952 CACACACTATGGAGGCTGAGAGG + Intergenic
1161075013 19:2281265-2281287 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161075035 19:2281351-2281373 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161075055 19:2281437-2281459 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161075074 19:2281523-2281545 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161075096 19:2281609-2281631 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161075108 19:2281652-2281674 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161075128 19:2281738-2281760 CACACAGCAGGGCCCCAGAGAGG - Intronic
1161357102 19:3825287-3825309 CACACACGCTGGGGCCAGTGGGG + Exonic
1166315603 19:41987929-41987951 CACTCACGTTGTCACCAGAGGGG + Exonic
1166995888 19:46719544-46719566 CATACAAGATGGGGACAGAGGGG + Exonic
1168270148 19:55245457-55245479 AACCCACGGTGGCGCCAGGGTGG + Intronic
927577046 2:24208705-24208727 CCCACACAAGGGCGCCTGAGGGG + Intronic
949039804 2:241842968-241842990 CACACACGAGGTCCCCAGAGTGG - Intergenic
1175994268 20:62805241-62805263 CACACACGATGGGGCCCGGGAGG - Intronic
1176383366 21:6124946-6124968 CACACGCGAGGGCCCTAGAGGGG + Intergenic
1179740102 21:43413293-43413315 CACACTCGAGGGCCCTAGAGGGG - Intergenic
1183038203 22:35156327-35156349 CACACACACTGGCAACAGAGCGG + Intergenic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1185008482 22:48299692-48299714 CACACATCGTGGGGCCAGAGGGG - Intergenic
1185304124 22:50103131-50103153 GACACACGAGGGCAGCAGAGGGG + Intronic
955224642 3:57050620-57050642 CAGACAGGCTGGGGCCAGAGTGG + Intronic
955327419 3:58020027-58020049 CACACACCATGACACCACAGGGG + Intronic
957992568 3:87645986-87646008 GACACAGGATGGGGCTAGAGAGG - Intergenic
960489545 3:118297594-118297616 CACACAGAAAGGTGCCAGAGTGG + Intergenic
967916772 3:194584146-194584168 CATCCACGATCGTGCCAGAGGGG - Intergenic
985682070 5:1261084-1261106 CACACATGGTGTCTCCAGAGGGG + Intronic
986174488 5:5340484-5340506 CACACACGAGGGAGCCAGCGGGG - Intergenic
990162342 5:52956176-52956198 CACACTCCATGGAGCCAGTGGGG - Exonic
994732378 5:103507871-103507893 CACCCACCATGGTGCCAGAGGGG + Intergenic
998565027 5:143209375-143209397 CACACAAGATGGCAACAGAATGG - Intronic
1003400560 6:5787025-5787047 AACACAGGAAGGCGGCAGAGAGG + Intergenic
1004160318 6:13206902-13206924 CACAGACGATGGCCCCAGCTGGG + Intronic
1004485586 6:16063362-16063384 CACACAGGATGGATACAGAGTGG - Intergenic
1005886689 6:30102492-30102514 CCCGCTCGATGCCGCCAGAGAGG + Intergenic
1014406773 6:121062551-121062573 CACACAGGATGGAGGCAGAGAGG - Intergenic
1018449520 6:163894114-163894136 CACACAAGATGGCGAGGGAGGGG + Intergenic
1022288618 7:28979174-28979196 GACACACAATGGTGGCAGAGAGG + Intergenic
1026307480 7:69154579-69154601 CACACAGGCTGGGGCCACAGCGG - Intergenic
1034200948 7:149282467-149282489 CACACACAATGTCACCAGAAGGG - Exonic
1035292237 7:157846652-157846674 CACGCATGATGGAGCGAGAGAGG - Intronic
1035292267 7:157846892-157846914 CACACATGATGGAGTCAGAGAGG - Intronic
1035292291 7:157847092-157847114 CACACATGATGGAGTCAGAGAGG - Intronic
1035292306 7:157847212-157847234 CACACATGATGGAGTCAGAGAGG - Intronic
1035292355 7:157847612-157847634 CACACATGATGGAGTGAGAGAGG - Intronic
1035292377 7:157847822-157847844 CACACATGATGGAGTGAGAGAGG - Intronic
1041967318 8:63694355-63694377 CACTAATGATGGCTCCAGAGAGG + Intergenic
1050171555 9:2824749-2824771 CACACACGATGGCGCCAGAGTGG - Exonic
1053426852 9:38015901-38015923 CACACACCATGCCCCCAGTGAGG + Intronic
1054948611 9:70824241-70824263 CACTCAGGATGGCCCCAGGGAGG - Intronic
1057182243 9:93036447-93036469 CACTCAAGATGGTGCCAGTGGGG + Intergenic
1060494892 9:124111440-124111462 CACCTAAGATGGAGCCAGAGAGG + Intergenic
1060822009 9:126666590-126666612 CACATAGAATGGCGCCAGTGAGG - Intronic
1061734839 9:132647202-132647224 CACACACGTTGGCACTAGGGCGG - Intronic