ID: 1050176330

View in Genome Browser
Species Human (GRCh38)
Location 9:2873048-2873070
Sequence GGGTAGCACTGGGGGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050176330_1050176339 9 Left 1050176330 9:2873048-2873070 CCGACTTCCCCCCAGTGCTACCC No data
Right 1050176339 9:2873080-2873102 GCCACCCACAAAGCCCAACTGGG No data
1050176330_1050176343 14 Left 1050176330 9:2873048-2873070 CCGACTTCCCCCCAGTGCTACCC No data
Right 1050176343 9:2873085-2873107 CCACAAAGCCCAACTGGGTGTGG No data
1050176330_1050176338 8 Left 1050176330 9:2873048-2873070 CCGACTTCCCCCCAGTGCTACCC No data
Right 1050176338 9:2873079-2873101 TGCCACCCACAAAGCCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050176330 Original CRISPR GGGTAGCACTGGGGGGAAGT CGG (reversed) Intergenic
No off target data available for this crispr