ID: 1050177573

View in Genome Browser
Species Human (GRCh38)
Location 9:2884127-2884149
Sequence ACCCTTCCTGGCCTGTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050177573_1050177578 14 Left 1050177573 9:2884127-2884149 CCTGGGCACAGGCCAGGAAGGGT No data
Right 1050177578 9:2884164-2884186 TGTCCTGCTGCATCACAGGATGG No data
1050177573_1050177580 16 Left 1050177573 9:2884127-2884149 CCTGGGCACAGGCCAGGAAGGGT No data
Right 1050177580 9:2884166-2884188 TCCTGCTGCATCACAGGATGGGG No data
1050177573_1050177582 21 Left 1050177573 9:2884127-2884149 CCTGGGCACAGGCCAGGAAGGGT No data
Right 1050177582 9:2884171-2884193 CTGCATCACAGGATGGGGCAAGG No data
1050177573_1050177577 10 Left 1050177573 9:2884127-2884149 CCTGGGCACAGGCCAGGAAGGGT No data
Right 1050177577 9:2884160-2884182 AATGTGTCCTGCTGCATCACAGG No data
1050177573_1050177579 15 Left 1050177573 9:2884127-2884149 CCTGGGCACAGGCCAGGAAGGGT No data
Right 1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050177573 Original CRISPR ACCCTTCCTGGCCTGTGCCC AGG (reversed) Intergenic
No off target data available for this crispr